Description :
From Genome Similarity Track
Location :
Scaffold_347:18506- 26084
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_347-snap-gene-0.14Inositol-3,4-bisphosphate 4-phosphatase
Pytul_var.sporangiiferummaker-pug3_contig_347-snap-gene-0.19Dual specificity protein phosphatase

Sequence
7578 bases(100 bases per row)
TTGATGTCGCTGGCCTCCAAAGCGCCAATTTTATTCAAGCTGAAAAAGAGTGTCATCAGTGGCCCAAACGGCGGATCCAGCGCAAGTATGAGCGTTATCC
TGACGTACGAGAAAACTACTGGAGCTCTTGCGTCTACGTCGACGACCAGAAGAATGCGGGAGATCAGCGTTGACGTGCTGACTGAGTTTTCATCTGTGGC
AGGCACCAATTTGGCTGCGGTGGAGCTGGTGTCGATGGATGTTCCGAAGATTGACGACGGAACCGTGCATTCCTCGTTAATTTGGATGGATGGAGACTCG
AGCACACTTACGCTGTCGTTCTCTACGTCCACGGTGATTGGCAATACATCTGTTGATCCGAAGGTTTGTGTCAACTTTCGGCCTTCTGCATGCAGGAACA
AGGGACGCATTCCAACGGCCAATGTGACGTTTCAAGACCTGGCGCGCGCAGCATACATGAAGGATGGAAATCCATTCATCAACCTGTATTCGTTACCAGG
CGACGCTCATTTGGAAATCCAACCGGTGAATGAGACATACTTTTGTATCGGGAAATTGCTCCCGACAGGCGCCGGCACCAATACCAGTTGGGAGATCAAC
TCGGATTTCACTTTCCAGCTGCAAATCGCAGGTATCATGTGGTCACAATCAAGTGTAGTGGCTAACACTACAGGCCGCTTTCCATTGCCGGTGCTTGCAG
AAGTGGTTCTCATGGATCAAGACGCGTTACAAGGAAGCGACTGTGCACAGCTGCTTTCGCATGAATCAACATGTAAGAAGCCTTTCATTTCACGTTTGAA
GTATGGTGTCTATGTATTAACTTGTCTCATTGTTGCAGATTCGAACCATGGATTGAGCGTCTACAGTGTGATGTCAGTGACGATCTATTCAGTTGCTCTT
GTGGGAGCGATCCTCATTACACGAATGGTAATTGGCTTTTGTTTTTGCTGCGGTTGATGGATAACAAGCAGTTTACTCACGTGATGCTTTTTGTATCTTT
GTAGAATGGCATTGCCTTTTCTAGCTCGTCGTTCTTCAACGATATGACCTCGATCATGGTTCTGCTCGTGCTTATACTTGGGATTATTGGCAACGCGATC
TGGATCCACGTCTCCTCCGACGCCCTCACCACCAACAGCAGCCATATTTACTATGTGCTTCGACAGATCACGATGTGCTGCACGTGGACTATGATGGTCT
CGGTCTGCTTCCACTGGCTATTGGTGCTCAGCGAGAGTCTTCGAAAGATGCGTCGTGTCTATGTGTTGCTCGCATATATTGTGGTGAATGGTGGATATTA
CACCTATGTATTGTACAGCATGATCACACTGACCGACTTCTTCAAGTGCACGTACAACGACTATTTGAAGAACCCACGATACACCAAGCGCCTTTGTGAC
AGCGACTATTGCCCCGATCTCCAGCCTTATCAATGGAAATATGCAACGGAAGAAGTGTGCAAGTACGTACATGATTCGTCATGGTACTTCCCTGGGGTGT
ATGGCGGGGAAATCATGATCTTCGCGACGGGTATCGTGCTGTTGATATTGGGCGCCTACGTCATTCGTCGCGGCTCTCGTCTGATTCAGCACTCTGGTGA
CATTTTCGACGACCGAATCACTTCGGTGATGAAGAAATCGCTGTGGACGTACCTTGCCGTCATTGTTGCCATTTCGTTCACGCTTGGTCTGTCGTGCATT
ATGAATCTGCTTCTGTACACTCAGAACTGGAAGGTCAACGCCGTTGTCTGGTACGTGTTTACCATTTGGCTACCGACATTGATTCCTCCAGCAGGGTTCC
TTGTACTTCAATGGAACCCTCGGCTGCACGGTATGAATTGGAATCCATCTCTGCACGTGAAGGAGCGTACTGTAACGAAAGACAACCTCGGGGAAAAGGG
GTGGGCGGACGGGAAAATGGAAAATTTGAGTGAGACCTGGACCGGGATCTCCAATTTTCCCGATACTGAGTACGCCCCGATTGGCGCTGAAAGCATCGAT
GGAAACCAGAACATTTTAGCGCTGTCTATCCAGCTCGCGTCCAAGGTACCAATTGCGCACGCTTGCTTTGTTGAGCTATATGTGGCAGACCTCAATGAGA
ACGACGTGACTGGTGAGGATATTTTTGAAGATCTTCCATCAGCAGTCCGCCATCGATCAAGCATCAGTTCGCTTCTCCAAACTGGCATCCAGCACGATAG
CTTGATGAACAAAAGAGGCCAATCTATCTCATTGAGAGCTTCGCTTATCGGCATGAACGCGTCAAGTTGGGTTCGTGTGGGCTTCACCGAAACGGTGCTG
CCGACCTTGATTCCAGATGCAGAATCTCCCAGCTCCAGCTCAGCGCAGATTGCAACGTTCTTGTCTGTCTTACAGGTTCCAGTGATGCCCTCGAACCCAG
TTCTGCGATTCGTGGTGTATGAATTACCAGATGACATCGACACTTCGCCAACCGCGGATCAATTTTCGCTAGAGCGACCAACTTTCAGCAGAAGATCTTC
TTCGATGCAACTGGACGAGCGAGCTCGGCATGCGCGAGTATCTGGGATGGGACTGGCGCCACCAATGCGTCCTCAAGTGTTTTGTGAATTTACGTGCTCA
GCCAGTGAGATTCTCGCGGCCGACGAAATGAATCTGATTGCTCGGGACGGATCCCATCGCCGATATATGGCCAATGCTGCGTTTAGCGATATCCCGGAAT
CTCCATCTCCAAGTGATAGCGAACCACCGCAACTCCGAATCAAATCCATGACTGTATCCACGCGGACGCTGAAAGAAAACAATGGATTTTACATTACGAA
GAGTTTCCAGTTTGCTGAAGGAAACGACATGGTGGTCGAAGATATGACAGAAAGTGTCTTCACAAACGAAATTCCGCGACAGTACCTCGAGCTTCTCCGC
ACCGAGCGAGCCGACGACTTGGCCCATGCACGAGCAGATCTCGCGGACTTTGAGACGAAATGCAAAACAGGACTTGTCGGTGGATTATACGACAACCTCA
TCGATCAGATTCAGGTAGCGTGGTGGTATTGATGCTTGGATTTTGAGCGCTCTCATCTTACTGATTCTTCAAAACAATCTGTGTTTGCTTAGGGTGAAAA
TGATCAAACCGTGGTGCAAAGCTGGTTGCAAGACCGTGTGCAACGACGCCGGATGTATGTCGATGCGCTCCGTGAGTGCCATCAAGTGTGCATTGATCGC
GCTGAAGCAGGGGTTAACTTCAAGGCGAGCACAGAGAAGAAAAGCCTGGTGCTTCGATTCCTGCCGATCAATCTGGTAAGTGATGCAAAGTTACACTATC
TTGGCATTCTACCACGCCTCACTTTCTCTAATATTTTTTGTTCATTTATTAGCATGTGCAAGATATGTGGGTTGGCCCGACAGCAGACCTTCGATCTCAA
CGAACGCGTCGAACATCGCCTAACGTGAAAGCGTACCCGACCATCACTGTCGGCGCTTTTGCAGCCCACTGCTACAAATTTCGCCACGCTGGTAGCATCC
TAAGTTTACGGAGCAAGCTGCAGAAACGGACATTGTCTCGACTTCACAGCGATCAGTCCGACCGTGGAGGCAGTGGCGTCGACAATGACCAAATGGATTG
GACGAAAGCAGAAGTGCGTTCTCACGACGAGATCTTGTGGCAGCTCACCACTCGAATGGATATGTGCGTTTCCCAGGCATTGACTGCGCTAGTCACTTCG
TTTTGTCGCTGCCTGGAACTAGCGCTCCAACATCCAACAGATCGCCAGTTCCTCCAATTGATCGATTCCATTGGCTTCCTCTTCCAGGTGGAGAGTTTGC
TGTCGACACAGGGCAAGGAAATCGGTATGCTGGAAGACTTCTCGGGGTCTGTCGAGGCGATGAAGAACGTGACTTTTGTCCTGGATACGTCTCCTCCACG
CCATCTGCCGTCCACGCTCAATCTGCACTTGAAGAACACGAACCTACCAAGTGTCGTCTCTGTGCGAGTCAGCAAAGGAGCTGCCAGTGGCGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATTCGCTGCAAGGAAGAGGTTTTGGCTCATCTTCCGAAGAATCTTCGCAACGGTGGATCGATTTCAGTCACTCC
CGTCATGTTTACCCAGGGCATCAATGAAATGCAGACTTTAGCGAACAATGCGAGTGGGAAGAAGACCAACCTCCAGGACACGATCAACCAGAAAAGCTTT
CGTGTGCTCGCTGCATATATCGACAAGTACACGATGCTTGCGACGAAACAGGTACGCTCTCTCTATCTCTACTGCGCTCGACATTGTTGCCTATCCGTTT
GCTGAAGTTTGTTGTTGTATTGTGTATTTTCTGACAGCCTGATGCAGTGCCAACGCCGGTATCCACAATCCTACCCCTGCTTGTATCGCTTGAAGAGCGC
ATCAAGGCCGCCAAGAAGCAGGTCGTGAAAACAAAGCAAACCAAGATCATTCAGGAGAGCTCCCGACTGTGTCGCCTCCTAGGCGCGGGTCGCGTGACGT
CCTGTAAAAGCGCAAAGGATCGCACGGGGATGTCGGTCACGCTGGAGCAGATCCAGTTGCTGAGCGAACACCATGGCTTGCCGCAAGAGTTTGTGATCCG
AACCGTGTCCACGATGCGCAGTAACGGCGTGCGACTTGAGAATGCGTTCAAGAACACTGGGAAGCGCCAGTACGCGTTCAACGCGCTCCAGCGCTCTCTT
CTCCCGGAAGAGTACAAGTGCCCCGAAGGCACCTACGGCCGAGGCCAAGTGAGTTAGCCTCAGCCGTGCACACAAAGTCTTCGTTTCGGAAGTCTTCAAC
GCCTACTGAGAGTATCTAGCGGAGTTTCTATTCGGATGTGCTTTCATGCCTCCAATTTTTGATTGTGTGATTGACTGAACGATGTTATTCGTTATAAAAA
TATGTTTGCATTTGAGCCCAGCAGTGTTCATGACCTCCACATCCTCAATAGTTCAAAGCAGTCTCCCCTGGCGGCTCTCGCGAGATGACCTTCGCGAACA
GAAAGCTGGAAAACGGTGTTCGTTGAAGGAGATCTGTCGATCCGTCAGGCTCTTATCGCACGTAGTGGTGCTGATAGCTTTGCTTTATCTGGAGCAGGTT
GTCGCCCTGGGTTTTCTCCGTGATGTGTGACTTGGGAGAAGGTGAGAGATACGTTGGTGTCTTGTCTGCTTTCTCTGAGTGCGAGTCTTGGGTGCTGCTG
CCACTAGCTGACTTGGTTTTGAAGATGCTGAAACGACTCGACGAGTGCTGTTCCTGGTTGCCGCTCTTGCGTTTACTGAAAAACGACCTTCGACTTGTTC
GCGCATTCTCTTCCTCCTCATTGTTGTTGTCCTCTTTTGCAGCATTCCACATTTTGTGCTGAATCGCGTCCAAGTACTGCTGCTGGGGGCCGATGACACT
TCCCGGACGGCAAAGTCGCAACCACCCGATGACTTCCTTGGCTGTGAACTTGCCATGCTTCATGAGGAACGCGCCGATGCAAGTTCCAGTGCGGCCAAGT
CCAGCTTTGCAGTGAACAGCAACAGCCCCAGACGTTTGCTCGCATGCCGCGATGAACTGGTTCAAGATGAACTCGGGCGGATTGCCGCCATCAGNNNNNN
NNNNNNNNNNNNNNNNNGAACTCGAGATCCAGATGCTGGATGCCTGCGCGCGTGAACCTGGTCTCGTCATATTGCTTCTCATTGAGCCGCACGACGAGCG
TCACTTTCTTCCTCTTGAAGTACGGGACGTAGTGCTCGGGTGTGAGCGTCACGTAGCCCTCGGGGCTTGCCGAGAACGTGTCATGAGGGCCAGCAAAGGC
CACAAACTTGGGCGAAATCCAGCTCAGGTCGCCGTTCTCGACCTGCTCGTAGTGGTGATACTCGTGCACGTCAAATTCGTGCGGAGTGACGTACCCGAGC
CCCACAGCGCGCGCAAGGCCGCTGATGCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGTACTCGCACTCCGTGGGGCTTGCGTCATGGAAT
GGAGGGAGCGTCATGCCTGCGAATTTTGCGACAGTGTCTTCAGGTTTCATGCCGTTGGCGAGCACGCCCCAGCAGCAGAGCAGACACACGGCGTTCGCTC
GAAAGTGCGGCTCGGGCGACGAGAAAAGCACGATCTTGCGCTTCGTCTGGCGCGCCGAGAGCACCATTTTCGTGAGCACCGTCGTGAATTGGATCGTGCA
GCCAAGGTTCAGCGGCCCAAAGTCCAGATAAAAGTTGTTGTAGTGCAGCTTGTCATCGATGGAAAAGTACAAGATACGCTCGTTGTCCTTTTCGTACGGT
GGAGCCCCAGCGATCGGCATGTAGTACAGCAAATCGGGGACAAACTCGACAGGTTTGACATTGTCGGCTATGGATCCTCGGCGCATAATGGACTTGGTTG
AAGTTTGGTTGTTGTGAACTCACGTGATGCTTGGCGAGTCTCAGCAACTATGAGTGCCCAGAGACAGGAAGTGCTCTCTCTTTTCCTTTTCCATGCCTGC
CGACAGCATGCTGGATTTGGAAAAAGCCTCATTCAATCTCCGTCCAAGACGCGCCTTTCGTATATGGATCCAAAGCTTCTAATAGACCAGCTTGATCTAC
ATACGAACTATTTGTGCCATGCGAACACTTGTAGTGGAAAGAGATACCCCTGCGATCCACGTTTTTTTTTCGCTCAATGCTTGTTCTTGCTACCGACTCC
GTTTTGGATGCATGGGAGGGAAATGCTTCTAAACATGGCGACTATATATATATATATATTGCTTTCCAAAATAGAGGAAGAACAAAAAAAGTATCAACTC
GAACCTTTTCTCACTATTATAATTAGGAGTTAATTTGTTCTAATAAAGATAAAAAATCGGACACTGCGGCTTCCACGACCATCATATCCTAAGTAATAGA
GAAAGCAACGATATATATATATAAAAGCTGCCAAATAGAAGAAACTTGCTTGCATTCACAGTGTTTCTCTGTCGTTTATTTGCTTCGGTGGCTGGTTCTG
GAGCGCATCGGACGTGGATCTGGATGTGTTTTATGTCTCGGATTCGCTGAAGACAAAGGCAAAGGGGGAAGGAAGGCGGAGGGGCTTCATGGTCTCCATC
CGTCCTCTCCACATATATAGTCGCCGCAGGGAAGAACAAGAGCTCCCACTTTCAGTGCTCTGGTCTCTCTCTTGGGCATAATAATTAATTAGGGGGGGAG
GGCTTTTGGTGGATTTAGATGCCGGCGGTGTGGATCTCTTCCTCGGGATGCAGGTCCACGTTCGCGGGTCCTCGAGCTGCAAACCGCTTCTGCGCAAACG
CCATCAGGCGACCACGCACCTGCTTGTGCACGTTCTCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGTCACTTCCATGCCG
ACGAGCGCCTTGGGGTAGTACTTGATCATGTCGGCGCCCAGGTACGCGGTCGCGCCCGATGTGAGCTGCACTTGCACC