Description :
From Genome Similarity Track
Location :
contig_59:185000- 187464
Transcript NameFunction/comments
g11075.t1POM80058.1 Casein kinase II subunit beta, partial [Phytophthora palmivora var. palmivora
g11076.t1XP_009535131.1 hypothetical protein PHYSODRAFT_521596 [Phytophthora sojae

Sequence
2464 bases(100 bases per row)
GCCGGTGTAGTACTCACTGGAGCTGTGGATCTTGTAGCCGAAGACGCGCGGCACATACGTCTGCGTCGGCGGCGCCACCACGAGGTGGGAATGCGTCATA
AGGAACACGTGCGGGAACGTCGCGCCAAAGTACGCGCCATCGATTTCTGCAAATAAAAGTCAACAACAACATGAGCCTCTCGCACGTCAACTCAGCCCCC
CCCCCTCTCCATCTTGCAACGTACGGCCCGCCCGCTGCGACTTGGGGAAGAAGATGTCCCTGCACTTGGGGCAGAAAACATTGACGGTCGTGTGTCTGGG
CACGTCCGACTGGCCAACGGGAAGCACCGGCTGCCCTTGGCAGTACACACGATGGCAGCGGCCGAAGTCGACGTTCTGGTACTTATCAAGCATGGCGGCC
ATGCCCTTGGTGGTGAGGATGTAGCGCGCGTGGATGAGTCCGTAGAGCATCTCTGCGGCGGACTCGATCATCTCCTGCTGGATCTGCGTGAGGCTGCTGT
CGTTGGGCGTCTCGATGTCCAGGATGATGTCTAGCGCGTAGTCGTAGTACGGGACGATGCTGCTCAGGCCCGTGAGGTTGAAGTCGTCCTCGATGTAGTC
CTCGTCCACCTCGCACAGAAAGCTGTTCTCGCGCAAGGAGCAGAACCACGCGATCCAGCTCGTCTCCTCCTCGTCGCTGCCCTCCACGTCGTTGTCCTCG
TCGTCGTCATCATCGTCCTCGTCGAGCGCGCTCGAGTCCTCCTCCTCCTCGTCCTCTCATCCTCCGAGACGCTGGCAGACGCGCGAGCCGCCTCAGACAC
GCGCAGCTCCTCCATGTGGCCGAACAGCCGCTCCATCTCGGCCTCCTCCGCCGTCTGCGCTGGCTGGCTCATGATGCGTCCCTTTGGCAAGGAATTGCAG
GGCCTAACGGGAGCTTTAGAGCGCTGCGAGAGCCGCGTTGCACTCGCTCGCGTCTCTGGATCGCTCCTCTGGCACGAGAAGAGCGCGAAAGGGGATGCAC
GCACAGATACACTGCGCTGCTCTAGTCGCACGCAACCTGCACAAAGGTCCGCCGTCGCTTTCTTCCCGATTAGAGCCAAGCGCTGGCTTGGAGGCGGTCG
GATTGAGGGTACCGCTTTCAAGGTACATTGTGTGGAATACGTAAACTCTAGCCATTTTGGCTTCATACATTGTAGCCATTTCTACAATGGCCGCAGCGGA
CAGTTCCTCGACGACTTGGTACGAGGCCTACGCGTCTGGGGATGAAGCACGGCGAGTGGATGGAGAGGAAGACGGAGAGGAAGAGTATGAGGAGGTGGAG
GTAGAGGAGATGACGGATGACGAGCCCATGCACATCACGGGGCGTCTGTTCCTCGGCTCCATCGACGCCGCCAGGAACATCAGTGCACTGAAGCGACTGC
GCATTGGGGCTGCGCTTGCGTTGCTGGGGAAAGGGGAAGAGGGCGCAGCAGTGCCGAGCCACACAAGTACAGTCGCCGAAGTGTACGCGGAGTTGCAGAT
TGCGAGGAAAATCGTTGAGATTGAGGACTCGAAGGACGGGGACTTGCTGCGGAGACTGCCTCGGATCTTGGCTGCATTGAAGAAGCTTGTGTGAGGAGCT
GGATTAGATGTGTTGCTGTAGTATTGTACAGATGGCGGGCTGACGTTGTCGTGCGCTTGGATGCTGGCTGAACAGGGAGAAAGTCGAACATGAGAGCAAG
AGCGTGTTGGTGCATTGGTACGTTTGTCACTGAGCTAAACACAATCACTTGCGTTACGTTTTCGTATTAGATGGACATACTCACGGACTTGATTGCCTTT
TTCAAACTGCAGCATCGCTGGTAGATCACGCTCTGCCGCTGTTGTGGCAGCGTGGATGCTCGTCAACAGCTCGGAGCGACAAAGTGTTCAAGATTGTGTC
GATCAGATCAGGTGAGAATGCGTGGTGAAATGATTACAGTTCTTTGCAACTGTACGCAGACATTGGCCTAACAGAACTTCGCATTCGTCCCAGGATCATC
CGTCCGTGGATTGAGATCAATCCGCATTTCATACGAGACCTGCATCTGTTCCAGGCCATCCTGGCTTCGACCCATGGGGCATTACTGAGTTCGGAGAAAA
CTGCGTTGCTAAAGGATCGATCTTTCCCGCGATTGGACTTCGGTGCGAACCTCGTCGAAGGTGTTCTCCAAGGCACGAAGACGATCACGATGCGCTTCTT
GTCCGATGTCGAAAGTGATCACAATTCGGACTTGAAGGACATCCACCTGTTCTCGCTTGTTGCAGCAACGACCTCAAGCACAGATGACACCTCGATGCGG
CCGCAGTTCGCTTACCTGCGGATAGACCAGATCGAAACCAAGGAGCTGAGCGGCATCGACGACACTACGCTCCACAAATCTGGATTTGCGTCAACCGATG
AGGTGATGGCAGTTCTGAAGCAGTTCTACCCGAACGTGACCGCCACGACCCCATTGCTGATGCT