Description :
From Genome Similarity Track
Location :
Scaffold_741:1850- 5578
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_741-fgenesh-gene-0.0N-acetyltransferase
Pytir_DAOMBR486maker-pir_contig_741-fgenesh-gene-0.3Disease resistance protein

Sequence
3728 bases(100 bases per row)
CGCCATTTTTTCAACGTCACCTTTCGCAGCTGGAATTAATCGAGTTCACGATGGCGAAAAAGACCAAGAAGTCAGGCAAAAAGAGCAGTGGCAATGGCAG
TGGCAGTGGCAGTGGTGTGAGTACGAATGCGAATACGAATACGAGTGCAGGCGAGATGTCGCGTAAGCTGCGGCCGCACGAGGTGGTGCTCGCGGCTGCC
AATGCGGTCGCGGACGTGATGGCCGACTTCCCGGTCTTCTCCAGCTTCAAGCGCAACGGCGTGAACGCACGCATCGAGAGCAAGCACGCCGCGGAGCTGG
ATGAGGCGACGAGAGACGCGATTGTGAGCATGTTTGAAGCCAACATGAAGCACCAGTACGAGGGCTCGGACTGGGGCTACGACGCCGTGGCGAAGAAGAC
GGAGCTCTTCGAGGACGACGAGCGCTATCTGCTGGCGCTTGATGTGGATGCGGATGCAGACAACAGCGAATCATCGCTCTTGGGGTTCGTGCACTTTCGG
TTCGTGGACGACGACGACGTTGAGGTGCTGTACATCTACGAGATCCAGATCGCCGAGAGCATGCAGCGCAAGGGGCTCGGCAAGTTTCTTATGCAGATCC
TGCTGCTCGTGGCGCGCAAGCAGCGCATGAAGCTCGTGGTGCTCACGGTCTTCAAGAGCAACGCTTCAGCGATGGCGTTCTACAGGAACAAAATGGGCTT
CAGCATTGACGAGACGTCGCCGAGCGCCTGCGGAGACCAGTCGCAATCGTACGAGATCCTGAGCAAGGCCGTGGACTCGGCGTTCAAGTGATCACTGCGA
TGACCAAGCAAGTAGACTAGAGACAACACATCTGCAAAGAGAAGAACACAAGAACACAAATGAGCTCTGGAATGAATGGTAAAACACTGCAAAACTGGGC
TTCATTCACATTTTCTTAAACACTGAAGACTCGCTCGGCATACTTGGGAATCGGCCTCCACCCTGTCCACTCTCGAGCGACCGACGCTTGTTCGTTCCAA
ACGGGTCTCGAGCGGCGCAGGAGGAAGAGATCCGGAGCTCGCCACTAAGAAAAATGCTTAAATACTCGACACAACTGGACGCACAAAGGGAGAGAAAAAG
GCTCACACTCACGACAGCGACACGCCACTTGGAAGGCCCGCAGACCAATTTACCCCATCGGTGAGGTCTGCGCGCTCTCCGACCATCAATAACAAACACA
CCACAGACGACAGCACCCGAGTCTGTCCCCACAAAGCAGTCGATTAGCTTGACCAACTGTTTTGCCTGTTGCTGCTTGGCTTACGCCGTGATGAGCGAGC
CAGCGGCATCCGTGAGACTCGACTCGAAGTCGTCGGCCTGAGCGTCCTCGTTGAAGTCAATGTCGTCCTGCTTCTCCTCGCGGATGTGCATCGTGCACAT
GCCCTGGTTGCGCGACAGCTTCTTGCAGCCGTCGATCTTACACAGGCGGCCGCGACGGTGCACCTCACAGAAGCCACCGCCACGGTCCGTGCGTACGCAG
CCGTCGATCTTGCAGTTGCGGAAGCCACCGTGCGTCGCACAGAAGTTGCCGCGCTGAGCTCCCTTTGGGCAACCCGACGCCTGGCAGCGCTTGCCGCCGC
CGTGCGCGCGGCACAGACCACCGCCCTGGCTGCTCTTGTTGCAGTCAAGGAACTTGCAGCGAGCGCCGCCGCCGTGCGCCTTGCAGAGGCCGTGGGACTG
CGCTGCCTTCGCGCAGCCCTCTTCCTTGCACTTCTTGCCGCCGCCGTGGCCGATGCAGAAGTCGCCGTTCTGACTCGACTTCTTGCAGCCCTCGATGCTG
CACTTGCGGCCGCCGCCGTGGGTCTTGCAGAAGCCCTTGGAGCGCACGCGACGGTCACAGCCGCCAATCTTGCAGGTCGCCATGTTCTTGGCAGATTTTG
GCGTGTGGCCGCTGCTGATAAGCATGCCGGAGAGCGCCATCGCCGACGCCGATGCTGGGGAGCTCGCCATCTCCTTGCCGTGAGGCGAGAGCAACAGTGG
CAAAGCCGCGCGGCTGTACACGCCGTTGCGAGGCGTGATGAGGTTACTGTTGCTGTTGTGGCGAGCCGCCATCGCGTGCTGCATGCTGAACTCGTTCTGC
TGGAAAATGTCGTGGTTCATGTCTGGAAGGAGACGGTCAAGCGACTCGATGGCCGACTCGAGCTGCTGGATGTTCTTGGGGCGTTCTGAGGCACCAAACA
CCGCGTAGCTCAGTGGCTCGAGGTCGAAGCTGTCGTCCATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCGTTCATCGACGTGAACGGC
ATGGGCTCGACGTTGATCCCCGATGACATTGGCGCGAATGCCTCGTTCTTGGCGTTCATGGCGTGGTGCTGGAGCTGGTGGTGCTGGTTCGAGATGCTGA
GCTCGAACATCTGCTGCATCTGCGCGACGTTCACTGGACGCGTCATCTGGTAATGGAGCTGCTGCTGCTGGTGCTGCGGTGACGGCATGACGTAGCCGTG
GCTGTGGTGGCGCGCGAGGGCTGGTGGCATAGCCATCGCGGCGTGGCCCGGGGTCGACGGGTGGTGGCCCGCGTACTGGAGCGGGTGGTTGATCTCCTGG
CGCATCATGGACACTGGGAGCGACATGTGGCGCGTGAGGTTGGCTGGCGGGCACGCGAAGTACGCGTTCTGCTGCTGCTGCTGTTGCTGATGCTGGAAGT
GCGGACGCGCGGCGTGCGTGGTCCACGAGTCGACGTCGCAGCCCATCATAGACATCTCGTCGCCGAGTAGCACGTCGTTCATCTGGACCATGGCGCTCAT
GGCCACTTGCTGCTGCTGCTGCTGCTGGATCTGGATCACCGAGGCCTCCGACGTCGCCTTGTTGCGTGGCGTGGACTCTGGGTTGGCGTTTGCCTGCTGC
GCGCTCTCAATCGACATGATGGCGCTGCTGGGTGTTGTAGCTGGTCAGTGAGACAAGTCCTGCTATTCGGACTCGAGTGACGGCAGCGTTGGGACGAAGT
GGATCGATGAGAGGTCTCCTGTGTGCCTTTACTGCGCTCGGCTTGATCGACTTCTACCGGTGGATGGGATTCTGGTAGAAATGCGGGGGTTGATGACGAG
GGTTGACGGGGGCTGAGGGGAATGAGGGCGAGACGCGTTCCTGTGCGCGGTCGACTCGTTCACCCGGAGAGCAACAATTTCGTTATGACGCCCTCTTGCC
CTCTCGCGTTCGCTTCCTTTTCCCGGCAGAGCCACGCGCGGGCCAGTCGACCGACGCTCTCACTCACACTCACAGTCAACAGCCAAGCCAAGGAGGAGGA
TCAGCCGCATATGGACCGGCTGGCACACCAGTGCACACGGTCGTAACACAAACACGGGACCGATACTGTAGATAGAGACAGCCTTTGGCTGTCCTTGGCC
TTCTTTCAGTGGGAAGCTCGCCGCAGATGGGCAGGCGCATCGCAGCCGCCGCGCCATCTGGTTGGGTCATTCTTCCCAGCTGGTCCACCTCCACCCAGGC
AAAGCCGTGGCGAGCAACGCACATGTGCACGGTGAAACAGACGGTCCCTGCGATCGAGCGCCCTATACACGCGAATGAGCAGGGAGGGAGTCCGAGCTGA
CTCCTTGAAGCTAAAGCTTTGCTGTCGTCGGAACAAAATCGTGGGAAAGAGAGGATAATCAATTTGTACAGCCGTCATAATAATACATGCTGGCTCGACA
GGTTTTGTCACTTGGAAATAGCACTATT