Description :
From Genome Similarity Track
Location :
Scaffold_571:185- 5305
Sequence
5120 bases(100 bases per row)
AGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAAC
ACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGATACTGTGCAAATTGAG
GTCTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTC
CCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATATATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGG
TCGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAGCATCATCTCGCAACCGTCTGTGATCTCCGTTGTCCC
ACGAAAGTTCGAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATACGAACTCAGAAGTATGG
GATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCCACA
CTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACAT
CGCTCATATCAGATCTATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCCTCT
ATAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACAGTGTCGGTGCGTCAG
ACCAAGTTTGCGAAGGACATCATGGAGAAGTTTGGCATGGAGAACAGCAACCCTGTCAAGACCCCTCAAGACCCAGGACTCAAGTTGACCAAGGCCATGT
GCGAAGGAGGATGCAACCATGAAGAGACCATGGCCTAGGTGCCTTATCGCAGTGCTGTCGGCTGCCTGATGTACCTCATGGTTGGAGCTCGACCGGACCT
CGCTGCTGCAGTGGGAGTTCTTAGCCAGTTCGCGGCGGACCCGTGTCCCACACACTGGCAAGCACTCAAGCGCGTCTTCCGCTACATTCAAGGTACGAAG
ACGCACGGCATCGAATTTCAAGAAACAAGTGAAGAAGGACGCCAAGGCTACTCGGATGCGGATTGGGCTAATGACGTCGAGACTCGACGCAGTACAAGCG
GCTACGCGTTCATGATGAACGGCGGATGCATCAGTTGGAGAAGCAAGAAGCAGCGCACGGTGGCGCTGTCATCGATGGAGGCGGAGTACATGGCGTTCAC
GGAAGCTGCTCAAGAAGCGATCTGGCTCAAGGCATTCCTGTGTGAACTCGCGAAATGAAGAGCGAGGATTCTGTCATGATTTTCGAGGACAATCAAGGGT
CGCTTGCGCTGGCCAAGAACCCCGAGTTTCACAAGCGCACCAAGCACATCGACATTCGCTACTACTTCGTGCGCGAGAAGGTTGAAGATGGCCAAGTGGT
GTTGCAGTACTGCTCGACGGAGGACATGAAGGCGGATCTGATGACCAAGCCGATCACCGCGGTGCAGCTCGAATATCTTCGCAACAAGCTGGGTATCAAG
CCACCAAGCGCGGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTT
TACGGTAAATCAATTGCGCAAACGGATGTATGCGCAAGCAGATGATTAGACGAACAAATTGATTGGACGAGTCCATGATTGAATGCACCAAATGATTGGA
TGCAGACTAAGATGTACATTGTAAAACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATCTAGTGTGTTAACGGTGTAGAGGTGTTGGAAT
GAAGCTTGGGGCTGAACGGAGTGACTTCTTGTCGTATAACTCCTCTTCCTTCAAGGGTCGGGTAGTCCGCGGCTGTTCAGGGAGTACGGTCTTGTTCAGT
GGCTGCAGGAACGGTAGATAGGAATACTAGAGAGTTGAAAATAAAAGTTTGTTGATTGGCTTGGCTTCCTCTTGAGTAGAAGGAGGAAAATATACGACTG
AGAGCTAACCGGAAGAGAGGCCTAACACCTTCTCGACCTTACATACACTACACTACGTATTTAGAGAAAAGGAAGGATTCACTTCGTTTGTTGTCTGCCT
TCGTGGGACAACGGAGAGCTTCTGGGAAGGGGCTTGATGTCGCGAGGTGCTTTTGGTCCCACGACGCCAAGACTCCGGCGTTCAGGGGCCCCCTTATAGG
ACCACCCTAACGGGCTCGGTCAGGGGCACGTGCGTGGTTGAGTTCAACGGGAACCACCCTGACGGGACGGCGGGGTGAGGAGTGATTCCAGGGTCTCGAG
TCATCCCGACGGGAGGCAGAGCTCCTGGAATGACCCCTCCGTTCCCGGGTACGGGACATCCTCCCCGACTTGTCGTTCGTCGTCCTCGGCGAACGGTTCC
TCTGCGTACATCTCTCACGTTAGTACTATAGACTCCGTCGTTAGCAGCTTCTTCAGACAGGGGAGGTTGGAACGCTTCGGGGTAGTCCTCGGAGCGGTCC
TCAACGTAGTTAGGGTCGGCGGCTTGAAAGTCATATAGCACCTCGACATCGTCGTCGACCCGCAGACGTTCGATGTTCCGAGCCTCGGCCATACTACGTT
GAGAAGCGTTGCGGCGGGTACTCGTCAATGCTAGTTTGACCAGCACCTTAGGGGAAACAGATCGGAGGGGGCTCCCCTCGTCGTATTGGCGACAAGCGTG
AGATACCACACCAGCGACCACCACGACAAGAGTGTCGGCGAGACTGCAGCCGGTCCACTCGAGGCAGTAGTTGGTAGCTAGTAGGAGCAATAGTACAGTT
CCCACACCCACTGGTCCCAGGATTACGAACTCCACCAGATCGAAGGCGTTGACCGGGATGTACAGCAGTAGAGACAGGCGTAGTAGCACTAGCCAGCAGG
TGGCTTCTCCCACCGCGTACAGGCGCATCCATGTGGCCTTGAGAGCGTCCCAGAAAGCGTACCAATAGCGTATGCTCGAATCTCTTGTACGGAGGAGGAC
TTCGAAGATGTAGTCGGAGAATGTCACCTTGCTGGCGATCCACCAACTCCGCAACATCCGTCCATAACGACCATACTTCTCTTCTCCTTTGAGTAGAACA
ATAGGAGGCACAGCAAATAGCGCGCTCCACACTCCATACGCGTAGGTAGCACCCCGAAGTTGACGAAGTTCGTTTGCCTGAAGTACGTCTCGGTATAACG
ACGCAGTCGCTCCAAATATCGCAGTTCAAGTTGATCACACGCCACACTTGGACCAAGAACTCCCAGGTAACGTTACGTAGAGGAGTCGTTAGGACCCAGA
CCGTTACAGCCCCTACGTACACGGGCCACAGCTCCCAGCGGGCGTACTCGTAGAAAACACTAGCGTGAGGCTCCATTTAGATGAGAGTACACTCGACAAA
TAAGAAACTGAGTACACCCAGGACGACCCTTCTCGACGTCATTCGACATCCATCCGTCTTAGTCGCCACCCATCCGTCAAGTCCAGTAGCTGGGAAAGGA
GAACTCCGATTCCTCGTCCTTTTCGGGAGCCTCTCTTGCACCCAATATACAGTTATCACAGGAACCTCGAGAGAGAGACAGGGCCGGAGGTCCAGGTACC
GACGGGCAGCCTTCCTGCTCATTTGGCAATTTGGCCCCGACTACAGACGCAACCCTCGGCGCCCTCTCTCCTCACCACCTCAGTATGGGCACCACGCGCG
GAACGGCAATGCGCCGACTCAAGGCCGTCTGGAACGTGGGGTCTTCGGACTCCGACGGTTCTTGTTCAGATGACACTCCGGCCGACGAGCGCTTCTGGAT
CCTCATGCGAGACGTCCTGGCTGCAAACGCTAGCTCCATCGGCCTCAAGCTTCTGGACAACATAGCCGCCGCGATCTTGGACGACACGGGGAAGGCTTCA
AACGCTCTGACGGGGCCGGTAGTTATCATGCCCAAGCCGCCTCGGCAACCGACTCGCGGGAAGCCGCTTCGGCACCCACGCTTCACGCAAGATGGTCGAT
TTCCGCTCAAGAGTGTCAGCACTGGCTCGACTAAGAAGAAGACGATCACGGAGAGTCCTCGTTCCGGCAAGAAGCGTCCGAGTCACCCGTGGTCTTCGTT
CGCGTTACTATTCAAGCTATCGGACACGACTCTTTCTCCCGTGGTCGATGATCTGAAACGGGTTTATTACGAGGCGGCCGAGCTAGATCAGGAACCGTAC
CAGCTGGCGTATCCGTGGCCGGGCTCGCACTTGTGGTACAACCCGCAAGAGTACCCGCATGTGCACGCTTCTCACTGGCGCTTCTGGAACGAGAACCGTT
CCAAGTTCTGGGATTGGCAGGCGAACGTCCCGTTGAGGACCTCCAACGCGCAGACCCAGCGGCGCAAGGCTAAGATGGCGGCAGTAGTCGCACGCGTCTA
GTTCCTGAGCATTTGTATCGAGACCTGGGGCTACTTCGGCTTCCTTCGTCTATTCGAGAGCTGTGCGCACCGTCGTCGCCTTATGTGGATGGGAGGACAG
CCTAGTCGGAACGCCCCAGACGCCAAGTCCTACAATGGCCCAGTCATCGACAACTTGTCTAAGCTGTACCGCGCGACTCAGGAGCGTACTCGCGAAAAGT
GACGAGCGCTCTCAAGCCGTTCCGGATCGACGAGGGAGGTTTCACGACCATCCCGGAGTTGTTGGAGCATACCGGAGCCCTGGACCCTAATAGCTCGAAG
CCCGACAGTCAGCTCACGGACCGGGCGTTGGCCCTCGTTCTGCTGGACATTAAGTCGAAGGAGGATCATGAACCTCATTGGGTAGGGGATCGTTCGAAGG
GAGTCTGGTATGCGCTTAGT