Description :
From Genome Similarity Track
Location :
Scaffold_3397:185- 2357
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3397-snap-gene-0.1Peptidyl-prolyl cis-trans isomerase FKBP4, N-terminally processed

Sequence
2172 bases(100 bases per row)
GGACATAAAACCCCACAACCCGTCGCGTTCCAGTCGGGTTGCTGGTGGGTTTGGTGTGGGAAAGTTCGCACGGAAGGAAAGGAAGCAGAATTTGCGCAAG
TAATTTATTTCTGAACTCCGGAAAGATTCCCATTTCGGCGGTTTCGTTGTGAAGGAGAAGGGAACCCCCACAAGATGTGGGAGGTTCTGACTATTTGGAC
CGCTGTGTGCGCGAGGTAACCAGCAGCACGGCGATTGTGGAGGAAACATCAAGCGCCACGCTATTCGCGCACATGGCTGGATAGTATAAACGCAATGCGA
GGGCTGTAGCTACACGATGCTGAACCAACAAAACGTCAAGTTTGAATCATGCAACACAGTCCGATCAGAGAGCATCCAGTACAGTATCTATTGTAGCAGT
TGGCCCTCTTTTTGCGCGGAAGATTGCCCGTGATACAGCGATGACGCACACTCGCACGGAAAGAACGCAGTGCTCTCGCCAATCAAAGCTGTCCCAGTCG
TGCTGCATGTGTGGCGCCAGCTGTCGTACGTGCGGTGGTCGCATGTGTCACAACTCGGTTTGGGCAGCTTCCACAGAGCGATCTTACTGTCATAACTTAT
ATTTCGAGCAAGTTGAAGTCGACACGAATAGATTACACACGCGACCAACACTCTGGTTGCCGTGGTGACCGTTTCCTTTTCCTCTATTTCCCGGCGAGAA
AAAAACATTGACGAGGTTCTTTTGAATGTTGCCGCCAAAGATACGGAGTGCGAACCCGTCAGTGTTCGCCTCACACTTCGTGTGTGGCCGAAAGCCCATC
CCCATGCGGTGGTAAAGTACCCTGTCCACTCTCCGCGCACGACAGCCATTCCATCCACGTCCACTTCTGGAAGGATCGAGCCAACCAAGCTCTGGGTCAC
ACTGGCTACCTTACGACTTCTGCTGCTTCAACGTGAGCACGGCAAACGCGGCCACACCAGCTGTCAAGATCGAAGCCGCAGTCAATACCTTCGTGGACAG
ATACCACGCGTCGCCCTCCCCCACGTCCGCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGGTGCTCCCTGTCGCTTCGACTTGCGCGTGAA
AATGGAAGCGTCCGCGTCCGCAGTGGCCGCTTGCTTCTTCTTGCGTGTGGACGCGCACTGAAACTCTGCGGCCACATCCACAGGCGCCGCGTCCTCAGCG
TCCGCAGCAGCGAGTGCCGTGTTCTCGAAGATTCCACCCCACGCCTTCCTCTCCGCGCTCTTTTGCTTGGCAATGAGCTTGGTGATCTGGTCCAGCAGCG
TGCGGCACGCCTTGTCCTTGGGGTTCAAGCGCACGGCAACCATGAGGTCGTTCCGCGCCTCCAGCAGCTTGCCCAGCTTGTAGCTCGCTTTCGCGCGACG
GAAGCGCGCCTTGGAAGGCCAGTCTTCAAACATGAGCTGCTCGCTGAGCCCGAGGCGGCCCATCCACGTGACCACCATGCCGTGCTTGTTCTCGGAGAGC
ACGGTCAATATACTTAGCGCATTTGTGCACGCGATCTCGGCGTCGGCGTACGCTTCAATCTTGAGCTTGCACGTTCCAATATTGAGGTGGCAACGAATCA
TCGTCTGCAGAATCTCGGCCTTTTCCTTCTGGGTCGCAGTATCCTGGTTCACGCGCTGCAAAAAGCCCAGAGAGCGCAAGTAGCTGAACACGGCGTCGTT
GAATTGGTTGTCGCGGAACTGCAGGTTGCCCTTCTCGGTGAGCTTGACAGCCTCTTCAATGAGGTCCTTGGTCTTCATGTCCTCGATCGACTTTTCCGGA
AGCTTGACGCCCTTGCGGTGCATGTACATCTTGGCGTATCCAGTTTGCACGACAATGACGTCGTCGTTGGGGCGGATCTCCACGATCTCGCCACTGCCGT
ACGGANNNNNNNNNNNNNNNNNNNNNNNNAACCTTCATGTACATCTTGAGATGTGGCTCGTCCGGTTCTTCGGACACATCCGCCTGCCGCAAGTACGCGA
CATTCGCACGCTTGGCAGCAGGATCCTTGTCGAGCTGGACAACGTAGATCTTTGTGGCCGGTCGAAAGGATACGATCACACCACGACCGAACGGCGTCAC
CACGCGGGTCTTGTCGGGCAACGGCGGGCGGCCGACCGCACCCGGGTGGTAGGCATCCGCTCGGAATCGGTT