Description :
From Genome Similarity Track
Location :
Scaffold_2374:185- 2217
Transcript NameFunction/comments
Phyta_totarag14425elicitin, putative
Phyta_totarag14426hypothetical protein PHYSODRAFT_469633

Sequence
2032 bases(100 bases per row)
GCAACTATCCGTGACAGCCTATCAGCTCTGTAGCGCTTCAACGCGAACAGCTTCTCCCGAACGACAGTCGAATACCAGCACAGTTGGTGTCGACGTGAAA
GCTTATGAAGAAAGCGaagttacatgtagtggcaTACGCATCGTTGCAGATGGGTTCTGAGGACTGATCACGGTGCTGCTCGACGGTGGGACCGCGACCA
GTCTGGGGCTTCGTTGACTTAGAGATAGCGTCGGAATCGCCACAGTCAACGGGTCGATCAAAAAGGTGGTTTGCCTAAACACAAGGCCCATAAGCCTTAA
GGCTGCAGTTAAGGCACGCTTCCCCCTTCAGCTACGCCCCACTTCCTTATCGATGCCTCGCCCAGGCTTGATGAGGCGCCAAGTGCATTCGGCATTCGTC
ATTCATTTTGGTATTAATATGTAGTAAGACGACTGCAGTGCATGTACCAATTTCCTGCGACGGCGGAAGCGGGTGTACAATATTTGCAATCTTGGGACCG
AATCTTCGTGCGGATGGTCTCAAATGAGCTCGGGATCAGATGATCATGGTTTAActagttgaagttgcatgGTCAGCAAACTCCCTCCGAGCTTTACGCC
GTGCTACGGTAGTCACAAGAGCAGCCATGGATCGCTTTGGGTGGACCGCGGAAGTGAGTCACTACATGTAGGGTAAAGCTCCCTGAATACCATCCTTGTT
GAAGCGGGCGCATGCAAGACGGTGCCCTTCTTGCAACGGTCAGTGACCGTCGATCACACTTTTTGGCTTGAAGTATTTCCCGCTGCTGGGTGGCGTGTGC
TGTTTGACGAGAGCTCTCGGCCATGGACGCTGTCCTTGCTCCGTTTCGAGGCTTGACCTGAAGCTCATTATCCAATTTCCACCCCAGCCCCAACACCAGC
TTCCCCCACctctctcctcctcttccaaaACCGTGAAGACCTTCGCCtacgccgccgccgctgctgtcgcttgcCTCGCCACGCAGACTGCCGCCTACGA
CGAGACCACGGTGTGCCCCTCATCGGAGACCGTTAAGCTCCTTGCCCTCGCCGCTAACCAGTACCTGGACTCCTGCGAGAGCACCTCGGAATATTCATTC
GTCCCGCCTACGGCGTACCCCACCCAGTCCCAGGTCCTGCTCATGTGCCTGACATCGGACTGCTACTCGCTCATCGCTGACCTCCTGGACCTCAAACCGG
CGGACTGCGTGATCGACTTCGGCTCGGTGTCGATCAACGTGCTGGAACTGGCGGAGAGCTTCCAGCCCAACTGCACGGCTCTCGGCCTCTCAGCCTAAGC
GATCAACTCGCTATGCAACGACTACGAGGAATGAAATTGATGTGACCGCCAGCTCGTAGTAATTGAACTCAAGAATGCAAGTTCCAGTTTGACGTGACGT
TGGGTCCTCGGATCTCAGTTTTTGTTGCtttgtacttcgaagtagctcTCTTTGGTTGCCTTTTATGCGTCCTTATGTATTTCTGGTACACGTACCTTGA
TGCGCCTCGACCTTCACTTTCCTCGATGCATTCTGGTTGTCGGGGCAGCATAAAGTCTTTGAGATGTTGTATCTTTTTGATGTGCCCTACCTTTGTCTGC
TTTCTTTACATTTCACATCGATACTCTTGATCCAAATTTGAACTGAACGAGTTGAGAGCTTttaccaccaccacggctATCGAAAATTTTGGCTACTGTA
GCACAACGATGCTCGTACTTGGGTTAGAGTCTAGCCGCGGTTCCCGTAGTTtccttgctgcagtgctgttTGATAACACGGCCCAGCTCCGCGTAGAATT
CGCGGTTTCTCGACACTGACGGGAACTTGTGGCCGCCGTCGTGCTCAAAGATCCACTTCTTAAACCCGTTTGGCTCTGCCTTGTCCGCCCACGACAAAGC
CAGTCGATGGGACTCATGGTAAAGCGGGTCTGTCTTTCCAATGAGGTGGATCGAAGGCAGAGGAACAGGAATGCGCTTGCCTTGCTTATCCAGGAACAGC
GACTTCACATTGACACCACTCACGTCCACCCC