Description :
From Genome Similarity Track
Location :
Scaffold_188:185- 17988
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_188-abinit-gene-0.58ADP-ribosylation factor 2
Pytve_DAOMBR484maker-pve_contig_188-snap-gene-0.12Charged multivesicular body protein 5
Pytve_DAOMBR484maker-pve_contig_188-fgenesh-gene-0.1ATP-binding cassette sub-family F member 2
Pytve_DAOMBR484maker-pve_contig_188-fgenesh-gene-0.6Serine/threonine-protein phosphatase
Pytve_DAOMBR484maker-pve_contig_188-fgenesh-gene-0.7Cullin-associated NEDD8-dissociated protein
Pytve_DAOMBR484maker-pve_contig_188-snap-gene-0.14EML5 (ISS)

Sequence
17803 bases(100 bases per row)
ATTCAAGGAGGAAGATGCGACTCGCAATGTCTCGCACGAGCCAGTCAATGCCGTCCACGAGTCCATCGCCGGTCACGGCACTGCACGACACGATGTTCCA
GTGGCGCGTCGAGAACTGCTCCGAGCGCAGCTCGAGCGCGTCGGCAATCTCAGCCGACGACAGCGCGCCAGGCAGATCCTGTTTGTTGGCAAAGATGAGG
AGTGTCGCGCCAGCCAGTTTCTGACCAGCACGAGCCGTCAGATACAGGCAACTACAGCAGCAGCAGATAGGCCGAGGCAGGCGTCGGAGCGTACCTCTTG
GGTCAGCAGCGCCTTGAGCTCGCGCTTGCAATCTTCAAGCCGCCGTCGGTCCGCGCTGTCGACCACCCAGACCAGACCGTCCGTCTATCAAGCACCACAG
TGTCACTACCAATACTCGAGCAGGCGTCATGACATTGCCGCAGCGATAAGCACCTGCTCAAAGTAGTTGCGCCAGTAGGCGCGGATCGTCTGTTGGCCGC
CGACATCCCACACGTTGAGCTTGAAGCTGCACACACGAAGCCATTAGCAATACTACAAACGCTACGATATCCACAACCACAGACACGCACTCCTTGTACT
CGAGCGTCTGGATGTCGAAGCCCAGCGTGGGCGAGATCTCGGTGATGTCCTGACCCATGAACTTCTTGAGGATCGTCGTCTTGCCGGCGTTGTCCAGACC
GCTACACCCCAACGACAGCATACCAAATTAGGCACACGCATAGCCACGCCCCTCTCACATATGAAGCGACAGCCCACAGCATCAGCACGCGGATCTCCTT
CTCCTTCTCCTTGACCTTCTTGAGGATACTCAGCAGACCCATCGCTCCTGCTGCTTTGCTTTCCGATGCTCTTTGGACACAATTTAGCTGAGTCTGAGAC
TGCATCTGATCACATCTGACCCGGATACTCTGCTTCCGCGTCGTTTCAGGGTGAGTCGCACTTGACCGACCGGCGCAGCATGACGAAGCAGCTCTCGACC
GCGCCGCAGTCCCTGCCGCGACCTGTGCACACACCCAGTGCTCTATCGAGACGTCCTCATCGTGGTAGCCGGATGGCGGCGGATCCGTCGTCGTGTGAGG
AGAACCAGAAGGACGGGTTCGATCCTGCCGATGGCCAGCCCGAGCTTGGAGTCGAGCAATTCGACAAGGCCACTCAGCCGCGCACGAAGCCCACGACGCT
GGAGGAGCTGCTCGACCTCGAGCTGGACGTATACCTCGGTCCGAATGCCGCCGACGACGGATGCAATCAGCGCCTCTCGGACGAGATGCAGTTTGCCGAC
GTATCACTCGAGCTACTGGTACGCTGATCTGGATGTGCAGTCTACTTTATGATTGGTGAACATGAGCGTCGCTTGCCATGACAGGCGCTCCAGAGCCCGC
ACGGTGGGAGTCAGCAGTGGCAAGAAGACGACGACGAGCGAGCAGCTGTCTCGGGCGACCAATGGGGAAACCTCGATACTCTTCGAGGTCTGTCGGCGCA
TTCGCCGCGAGGCAGTAAGTCGGGTGTGCGGGTATTAACGGGGGTATGACGGATGCTGATAGCGCTTGTCTCGGATGCTGCAGTCCCTAGCGTGAGCTCT
GACGGAGCAATTGATTTGACCTCGCCAAGCCACCATGTCCAATCCTTCCCGCCGTCGCCTTCCTATCCAACAAGTGGCGACGAATACGACCTAGCATCGC
CTGTTGCGTTGCCCGAGTCCCCGTCTCCAGTCGCTGAAACGCGTTCACTAGCGTGGAGCGGACTCCCGAAGCTGGTCTTCGACGATGAGGCCGAGATTCT
GCCAACAGTCACGGCTGGTTCATACCCCCGCACAGCGAGTATGTCGGTCCCGCGGCCGCGACATCGGAGCTACGCGTCGCCGCCAAGGACGAGCTCGCAC
AGCAAGGCGCCGCGGTCTGTGCACGCAGAGCGGAAACCGAAGGCCAAGCACGGCGGCATCTACTCGCTGCTGCTGAAACAGAAGCCCCCGGAACACGAGG
CGCAACTCGTGGACGACATTCTTAGCCCAGAGGTCCTGCAAGGTAAGCTTGCTCTCTGTGCTGCACCGCTGCCTCGTTTGGAGATGCAGAGTTGACGAAC
TGAATGATGGTTGCTCGCTGTCAGATGCAACATGGCCCAGCCCACCACCATCAGCGGTGCGTACAGTCGACCTCTGTTCAGATACTCCGATTCTGACATT
GCTATGCGCTCGCAGCAGGATAAGTCGTCGCCCAATTCTGTCAGCAAGCCGCAGCACGGCGGCATCTACCGCATGCTCCGCCGATCGAGTGGGAATCGTT
AATTCGGGGACAGACCATCCTCAGCTTCAACCTAGCGAGAATGCATGCGTATCGTTGTTTTGGGATTTTGGGCTACTGGATTTTTATGGATACATCGCTT
AAAACGGGGACATGGGGACACGACCCCCTAAATAGGATATATTGCCGATTTTCTTCTCGGAGAAAGCAAGCATTCCGACGGCATCATGGATCGGATATTC
GGCCGCAGGAAGCCCGAGGCGCCGACCGTCAACGTCGCCGATGTGAGCACCAAGGTGGACGGCCGCATCACCGACCTGGACCTAAAGGTGCGCCTGCAGC
TGCTGCTCGATTTGTGGCGTCAGTTCGCCTGCGCACCCGCTCGCATTGCACATTGTGTTCGCTCGTTGTCGCTGACATGGTTCGTTTGGAAACCGCCGCG
TGCAGATTGACAAGCTGGACCAAGAGCTGCGAAAGTACCGAGAGCAGGTATGCGTCGTACTATTGCCAATGAGAGTATGCGTTGCTTGGGTATGGGGGCA
TGACGGATGTGATGGTGTGCCGATAGATGTCGAAGGCTCGAGGGCCAGGTCTGAATGCGATCAAACAGCGCGCGATGCAGACGCTGAAGCGCAAGAAGAT
GTACGAGGCGCAGCGCGACAACTTGACGGCGCAGTCGTTCAACATGGAGCAGGTTCGTGCCTTCGAACTGTGGTGTCGAGTGGGGTACAGCTACAAACTC
AGAGTGCTGCTGTTCAGGCGTCGTTTGCCATTGAGACATCTCGCGACACGCTGACGACGGTGGCGGCCATGAAGAGCGCGGCGGTGCAGCTGAAGGCGGA
GACCAAGAAGATCGACTTGAACGAACTCGAGGTACCATCGCTCGCTCGTTAGGTGTTGGTGGCGCGGTCGAAAAGCTAAGTGGAAGTGGTTGTGCTTGAC
CAGGATGTGCAAGACGACATGGCCGATCTGCTGGAAGACATGAACGAGATCCAGGAGATCATGGGGCGGTCTTACGGGTGCGTTTTGGTCCAATTCTGTA
CACGATATTGGGCTTTGCCTGGCGGCTGGCTGCTGATGCGTGGTGTGTTGCTGTGGCGCAGGATCGGCACGGACGTGGACGAGAGCGAGCTGGAAGCGGA
GCTCGCGGGACTCGAGGATGAGTGGGCTGCCGAGGAAGACTCTATCGCGGCCGAGGCGGAGCAGACGCCGTCGTACCTCGCTCCTGCGGCTCGCCACGAT
CTNNNNNNNNNNNNNNNNNNNNNNGTCCGGCGGTCTGGCCAACCCCACTAGACGGACGACCGACGAGTTTGGTCTGCCGATTGCCTCAAGCACATGAGGA
GGATAGGGGATGCGACGGTGAACGCGGAGTGATTCCTGACATGTTTGTCGTGTCTGATTTTTGGCGGGGCGGCCGTCCTTGGCGCAGTCGCGGAGATGCA
GGCAAAGAGGAAAGTCGACGATGATGGAGCCGCCAGGCGACATGCGTCACTATACTGACCAGATCGAAGAGTATCCGGATAGTATACGTCGGTTAAACCC
GCAATGCGGGAGCGGGGTAGGGCTCGCTGTCTGCTGTCGTCGCTGCCGTCACCGGAACTTCAGACTTGTCTCCGATTGGCGGGCAGCTCAGCCAGCCAAT
CGTTTCATTTCCTATGCTTCACACTCCATTCGAGAGGATACGTATTTACATAGTTATCTGAAGGATGGATTCGTACTCAGGCATGCAATGCACTTGGTGC
CATTTACAAGGGTTATCGATTGATACTATGAAAATGAGGTTTTACATTTGCAGGTTTTTTAGTCTCCTCACTCGCACCCCTTGTTGCACCCCTATCTAGG
GGTCAATGGCCCCACTCCCTCCCTTGGACGGGTCTGTGGCGGGTACAGTTTTGGCTGCCAAGCGCTGCCTGCCACTTGCCCATTTGCGATCGTTGGTGGT
CCGTCGACCCCCAACGGTAGTCGCGAGCTCTTCCCTCCCTCCCTCCGCCCTCCGCCCGCGTCCCACCAGCAGCAGCAGCCATGCCGCCGCGCGTCAAGAA
GGAGCGCCGCGGCAAGAAGGAGTCGAAGAAGGCGGCGGCCGAGGAGAAGAAGAAGGCCGACCAGGCGGCCGCGCTCGAGAACATGTCGGGAGCCGACCGT
CTGGCCGAGGAGGGCATCATCGCCACGTGCTCGCACAACGTGCGCGCCGTGCACCGCAACTTCAAGGACATCAACGTGCTCAACTTCAGCATCACGTACT
TCGGCAAGGTGCTGCTCGAGGAGTGCGACGTGTCGCTCAACTACGGCCGTCGCTACGGTCTCATCGGCCGCAACGGCTCGGGTAAGTCGACCTTCATGAA
CGTCCTCGGCGCGCGCGGTGTGCCCATCCCGGACTCGATCGACATCTACCACCTGAAGCACGAGATCGAGGCGAGCGACATGACGGCGCTCGAGGCTGTG
CTGTCGGTGGACGCCGAGCGCCACAAGCTGCAGCACGAGGCCGACGAGCTCTCGGAGCAGATGGCTGACGATTCGCTTGGCGAGGAGGACCAGGAGGCGA
TCTCGGAGCGGCTCACCGACATCTACGAGCGCCTCGATGAGATGGACGCCGACACAGCCGAGCTGCGTGCGCGCTCCATCCTGTCGGGTCTTACCTTCTC
GGACGAGATGATGGCCAAGAAGACGCGCGAGTTCTCGGGTGGCTGGCGCATGCGTATTGCGCTCGCTCGTGCGCTTTTCATCCAGCCGACGCTGCTGCTG
CTCGATGAGCCGACCAACCACTTGGACATGGAGGCCGTCGTGTGGCTCGAGGACTACCTGTCGCGCTGGAAGAAGATCCTGCTGATGATCTCGCACTCGC
AGGAGTTCATGAACGAGGTGTGCACCAACATCATCGATCTGCGCAGCAAGAAGCTGGCGTACTACACGGGCAACTACGACGTGTACGTCAAGACGCGCGA
GGAGCTGGAGGAGAACCAGATGAAGCGCTACAACTGGGAGCAGGACCAGATCAAGCACATGAAGGAGTACATCGCCCGCTTCGGTCACGGTTCGGCCAAG
CTCGCGCGTCAGGCGCAGTCGAAGGAGAAGACGCTCGCCAAGATGGTTCGCGACGGTCTAACCGAGAAGGTGCAGCACGAGGCCACGGGCGACTTCAAGT
TCCCCGACCCGGAGCGGCTGCCACCCCCGGTGCTCATGTTCCAGAACGTCTCGTTCGGCTACCCGAACGGTCCGGTGCTGTACTCGGGCGTCGAGCTCGG
CCTCGACCTCGACTCGCGGGTCGCGCTCGTTGGCGCGAACGGTACGGGCAAGACGACGCTGCTCAAGCTCATCACGGGCGACCTCGTGCCGCTTGCGGGC
AATGTGCGTCCGCACTCGAAGCTGCGCGTCGCGCGCTTCAGCCAGCACTTCGTCGACGTGCTCGACCTGACCAAGACGCCTCTCGAGTACTTCCGTTCCA
TCTTCCAGGACAAGTCGGTCGAGGACGTGCGCAGCTACCTCGGTCGCTACGGCGTGTCTGGCGAGGTGCAGACGCAGATCATGGGCCAGCTCTCGGACGG
CCAGAAGTCGCGCGTCGTGTTCGCCTACATGGCCCAGCAGAACGCGCACATGCTGCTGCTGGATGAGCCGACGAACCATCTTGACATGGAGTCGATCGAC
GCGCTGGCGCGCGCCATCAACGAGTTCAAGGGCGGCATGCTGCTGGTGAGCCACGACATGCGGCTCATCTCGCAGGTCGCCAAGGAGATTTGGCTCGTCG
ATAACCAGACGATCCGCCCGTACCAGGGCGAGATCGGCGACTTCAAGATGCGCGTGCGCAAGCAGCTCAAGCTCGCCGACAAGCGCGTCGAGGTCGCGAC
CGAGGCCAACTAAAGCGGTTTGATCATACTCTCCACAAATACACGATACAACCTTCCTTGCTTGATGATGCATTGGCTCGGTCTGAGCAATCGTATCGGC
GTGTATCTTTTTTGTCGACGAGTTGTAGGTAGAGTTTGTACAGCGAGTTGAGGTCACTCGTACTCACGCACTACAGCGGCCGTGCGATGTCTAAGAGCTC
ATCAATCGTCGTCTTCTTGGTTGTTGTCTTCCCCATCGTAGCCACCGTTCTGATGCGCCTCGCTCGTCGATACGATCTCGGTCTCGAGCTCTCTGGCAGC
CTGCTCGTCGTCCTCTTCGTCGTCGTCAGTGTCATCATCGCCAGCTCTATCATAGCCCCGATGACTGTCCAAAATCCTCATCGATCGTGGCGCACCGGAG
CTCTCGCCTCCATCACACGAACCGCCCGTGCTGTTAACGACGACTGCACCTTGCCACACCGCTCCAGACACCATCACTGGCAAGCCATACGTCGCCACCC
TGCTGCCTGCTACACTTGCTCGACGTCGCGGTAGCTGCTCGCGCTCCTGATGTCGACCAAAGTCAGGCGATCGGTTGAACACGCGGATCTCCTGGTTCTC
GACCAGCACACACCCACACGTCGCGCGGCTCCCGGCACCGTGGTCTTTCGACGTCGAGAACACTGTCACAACGCGGGCCGTCTTCGCGATTGCAACTCCA
TCGACGACCGCCTCGTGCGCGCGGAGAATACACGACAGTCCGTGTCGCTGCAGAAACTCGTCCACTGCTCGCTCGCCGAAAGTCACGGCCGCACCGCCTC
TAGTATTTCGTCCAAACCCTTGCGCATCTAACGCTTCATCGTCTTGGCTCGGGTCGCCCCACAGCATCTCCGCCATCATGGAAGCTTGCGCTGGTGCAAG
GGATGACGCTGATCCGTGGTTGATGGCGTCTAACGAGTCGATCCTCGCTACAGCAGGCAACTTTTCGATAGCCTCGAGGGTCGTCCGTTCGGGGTACCCG
ACTAGCGGCCGCGGGATGCCACCATGAACACAGAACACATCGCGGTCGATCACCGCAGCGAGAGGCAACCGATCGAACGCATGGTTGATGCTGTCCCATA
GTGAACTGCCGCGGTCATCGCCGAAACGAGCCTTGCACTGAGCGAGCAAGCAGGTCGAGCCATACAGCATCTCGAGCCCGTTCACGGCGCGCGTCTCGTG
GTTCCCGCGGAGCAGGAACACTTTGTTCGGGTGAAGCACCTTGAGCGCTAGCACGTACGCGGCGACCTCCAGCGACGCAGCGCCGCGATCCACATAATCG
CCGAGGAAGAGCAGACTTCCTGCCGTCAGCGATACCCCGAGCGGTTGCCAGATGCGCTCAGTGAAGAAGCCCAAATCCATCAGGTTGCCGTGCAGATCAC
CGATCACGTATACGGGACTTGTGAGAGTTAGACACCGCGCTTCGGTCTGCAGCACTGCTCCAGCTACCCCACTCAACTCCACCAAATCGGAACAGAACGC
GAGCGAGTGGAAGTACGCGAGAGAAGAGAATGGATCACGGAAAGCTGCATCAACTTGCTCAGCGATTCGCTCAGCTGCTTTGTTGACTGCGGCGGGTGTC
GCCTTGCAGGTGGACAGCAAATGCCGAGACGACTTGGGGCTAGCGGCGAGATGCAGTCGTCCTGATGGGATCACATCCGTGTCCGTCACTGAGAAGAGTA
TCGGCGACAGCGCAGTCGTTGCGCTTGTAGCCGTCCCAACACTCATCGAGGTCGACACTTTGCTGACAGAAGCGGTCGGCTTTGTTGATGAGTTCGCGAT
CGGAGGCTTGAGCGCGGAGCCGGTGGAGCTCGTTGCATTCGCCGAACTTGAACGGCTCGCGAGTAGTTGCTCTTTCAAATACGCGATCTCCTTGTCGGTC
TCGCGTTTTAGCGCTTCTAGTGCCTCACGGAGTTTCTGAGCAGGCACAAGCGCGGTGTGCAACCAGAAGTCGTTAGAGCGTGGAGGTTATCACAGTCACA
GGATATCTGCTCACCTCGACCTCGCGCGCTGTCGGCTGTTCGAGGTTGCAGCAAACCGCATCGCTCGGTGATTTAGAGCTCGGCGATTTGGCGCTCGGCC
GATCCGCATAGGCGTTGTGCTCGTGGCTGAGTTTGCCGCTCTGGTCGATGGCGGAGAACCGTGGAGGCAGCTGATACTGCCGCTGAACCTGGATAGGTAA
AACGTCGAGCAGAGCCATCTCGCCCTCCCTCTTCTTCATCGTCAATCGGCGAATGAAGGAAGAAATTGCTCGTCGCTCTGTCTAGATGCGAGTTGTTTGC
AAGTGAGGGGGTACCGCTTGTGTGCGCCAGCGAACACGCAGAACAGCGATTTGATCGCTGGTGTTCTTTCCCCGCACCGGTGGATAGCTTGGAGTCTCAT
CGTGCTCATCATATAAATAGCATCCGGCCAGGATTCTCGATTCGTGGGCTTTGATCTGTGCAACAAACAGCAAAAGATCCGCCACCAAGCAAGCGATCGC
ACTCGAAGCGCCAAGTGATCTAGACAAACCTCACTCAGTCAAATGGGACGCGAACGACTAGCCATTGTGGTGTTCATCCTCGCCAGCACGTGGTCTCTAG
TCTGTCTGGATATGAGCGTGGCGGCCGTGGCGCGCAAACCGATCGACTACGACGCGCTAGAGCATGCGTGGGAGGCGGACGACGCCGACGAGGAGTTGCG
CTCTGAAGGTGACGAGCAGTTCCGCCGCCTTGCCGACAGGTGTGATTCTGTGATCTGTAGCAATGCGTGATGTGACACAAAAGTGATGCGATATCCTCAC
CAGCGACGAGGCTGACGCCAAGGCGCTCGGGCCGCAAATGTTCTTCGTCACACTCGATGACCGCCGACGCAGCGAATCGCTCGTCGATATCGCGACCCGC
TGGAAGGACGTATGTGCAACGCACCACCTGGCAATGCATGCTTCGAACGCTTACCGTGGCAAAAATTTGCGCTAGATGCTGTGGCTCGGTGGTGTCGAGG
TCAACATCTACGAGATGGGCGAGTCCAAACTGCTCGTGGGTCTTCAAAAGGGCTTGTTCGTTGACGATCTCCAAAGATTCCTAGAGCAGGAACCGATCAT
CAAAGAGTACGAGTGGAACAGCAACACCTACAGCACTGGTTCAACTCAGCACAGCCAACGGCACTCGAAACCGAAAGCGAAGGTCCGTCAGTCGACCAGC
AAGCAAGGCGATAAAAGCAAGAAGAAGACGAAGACGAAGAAGAAGGCAACTACTCCTGGGAAGCGAGGCAAATCAGCCTCGACTCTGAAAACCGATCTGT
GATCGTGCATTTTGTTTGTGCCAATACCAGCATGACCTGGCGTCATCCAGCTCTCCTTCGCCACTGGAGTCCTCACCATCTGCCACCATCCTCCTCCTCC
AATGTATCACGCACCGCTATCATCAAGCACTCAGACTCTCGCTTTTGACGGCATCGAACAGCGGCGACAGCGTCTTGTTGCGCTTGATATTCTCAAGCAT
GGCGGTGAATTTGGGGTGAACCTCAGTGTCGCGCACGGTACTGATAGCTTCGACTGCACGCAGCGCACTGCGGATCAGATCCTTGACGCGCTCGACCTCT
GGCCCCACCTGATCCTCCTTGACCTTCTTGTTGAGAGTCTTTTCGAGCGGCTCGAGCAGCAAGTCGAGCGAGCTCACGACTGTGCCCGGCTGGATGCGGC
AAATTTTGATCAGGATTGGGTGATTCAGCATCTGGATGTCATCCTGGTCGCGCAGTCCCTGCTGCAAATGCGGCAGAAACAGAGCAATGTCCACCTGCTG
TGGCAGCACTTCCAGCAGTGTGTCGATGCACGTGTACGCCGCCTTGCGAAGAGGCAGGCCGTCGTCAACCTTGTGCTTGAACGGACCGAGATCCACAACG
CGCTCAAGCTTCACCTCCGTCGTCTTGAGCAGGATCGGGAAGATACGCTCACGAATGTACGGAGCCAGGTACACTGCGTGGTGGTGGGCCGCCGTGTTCA
GCACCAGCAACGCAGCGCGGCGAACGTTCAGGTCCTCGTCTTCCAGAGCGGACAAGAACGGATCCACATTCGAGAACAGTACGCTGCTCGCCGAAGTCTG
CGCCGTCGCAGTTGTCGTCGTGAGTGCGAACTTGAGGCTCGTGACGGCGGTCCAGCGAGTGCCGACGACAGACGACCCACAAAGCTCAGAAATGATCGGG
ATCAATTTGTCGCCGTCGGTGACAGCGAGCTTGCCAAGACATTCAGCCACCATGTTGCGCACGCCTTCTTCATCGCGCTCGCTCAGCTTGCGAAGCACCG
GGAGAACGCGATCCACGTACTGAGAGAACCCGTGCGCGCTCGAGGTGCTTGTAGCGTGGTCAGAGATCACTTCACGCAGCGACGACAGCAACAGATACGA
GTTTTCGCCCTGCTCGAGCTTGACAATCACCGTTTCGAGGTACATGTCCATGTTGCCGACGCAAATACTGCCAAGCGCGTACGCTGCCGCTGCCTTGACC
TCCTCCGGAGCATTGCTGAAGCAGCGCAGTACAATATCCTTCACATCGGGATGCGCCGAAAGGTTGACGTGGCGACCGAACTCGCCGAGACAATAGAGCG
ACAGCACCGTTGCCTTCTCGGATGTGCCCTCCGTGATGTCGCCAATAAACTTGGTAAACGCAGCGTGGCGGTCGGTATCGGACGTGGCAGCGACGCAAAT
GGCAGCGACACAACGCGCAACGTTCAGCACCGAATGCTTGGACGCTTCCGTTTGTGGCGTCATCAATGCCGCGAAAAGATCCGAAAAGCTGCTGCCAGCC
GAGTTCAGCTTGGTCAGCTGAGCGAAAAGCAACTTCAGAGCTTCGAGCGTCGGCCCTTGGAGCATCGAGCTATGGCACAGTAGCAGAGCATTGGGCTGAC
ACTTGCTAAGAATGGCGTCGGTGGACGCCACTGTCGGGCTCACAGCGAGAATGTTGGAGATCAGCAGGATGCCCATGCGGCACAGCTGCAGATCCACATC
GACTAGCAGCGCCGACGCTTCTGACACCACCTCACACAGCAGCTCTTGGTTCATTTGCTTGCCCTTGTGCACCACGAGGTCGTTCAGTGTGTCGAGGGTT
GCCTGCTTGAGCGTCCGCGACTGCTGACGCAACAAGTCGGCCAACAGCGCCGTGCACTCTTCCAAAATCGGGGACATGTCCAGGTTGAGCGGCGATCGGG
CAATGACACCGATCGCCTTAATGCTGTGGATGCGCGTGACCTCGTTTTTCAGACGCTCCATCAATAGCGGATAGACTTCCGCATTGCGGGAACTCAATTC
ATCACCTGTTCAACACCGAAACGCTCGTTGTTAGTCACGCGACAAGAGAAACAAGAACAAGTCGTTGGAACTCAATGACTCACCGAACACAGAGACAAGC
TGTCCCACGCTGGTGATGGCCGTCTCCTTGATAGCCTGGTCAATGTCGTGAGCGGTGAGGCTCGGGAGAACAGCTTCAAACAACGGAACTGCGTGCGCTT
TGTATGTGACATCGGCAACATTGGGTCGGATGACCTGCACAATCGACTCGATCAAACCGAGCGCCTTGGCAACCGTCTTGTACCACTCGTCCTTCGCACT
TCGGATCGCCGTGTCGACGATTGCGCCGATATGATCCCGGAACGGCTCGACGCTATGCGTGTCGATGAGTAGGCGGAGAAACGTCAAAGCGTCCAGCTTC
AAGTCGGAATGCTTATCGGCCGCGGCGTGCAGTACATTAGGAATGATCAAGTCCACGTACTCGCCCAGCTTTCCGCGCTGGACCATTGCCAGCTCACTCA
GCAGCGCGATTACAGCACATCGTGATTGCACCGACGCCTTCGGTCCGAACTGCTTGTTGGCGCCAACCACGATGAGTTTCACACGCTGGTTCAACTCATT
CACGCATCCGTCGAAAGTGGGTGGGTGCTGGTGCACAATCAGTCCGCCGTTCGCTCCTGGGATGCGCTTCCGGGTTTCGCGAAGCAACTCCGTAAACACG
CCAAGGACATCGATACGGACATTCTCCTCGCGCTCTTTGAAGCGTGAGATCAGCGGCTGACTGAACTTGGCGTAAAACTCCTCAAGGATCTCCGGCCGAG
TTGTAATGACCGCCACCAGAACGCGGAGTCCAGCGCGGCGGACTTTCCAACTCGTGTCATCATCATCGCTGTAGTCGCCTTCTTCCTCACTGTACTCTTC
CTCGTCCTCGTCCATGGGTTCGTCCTCGTCCGCGGAGTCGCCATAGTTGTAGTTCGGGTCGTACTGGATGAACAGCATCACGAGGTGGATGATCTTCTCG
ATATGAGGCGTGATCTCGTTGTGGCACCGCACGACGAACGCCTCGAATGCCTGGAAGCAGTTGCTGCGCAGCTCATCAGATGCCTCGTTCTGCATCGACT
CGTCTTCCGGGTCGCCGCAAAACTGAACCAAAATGTCAATCACTGCATCCAAGTGTCGTCCCAAGCGGTGTCCTGCTGTGCGAGACAGCGTGCCCGTTGT
CTGAATCAAAGTGCGCACATCCGCAGAGTCGCTCGCTTCGCGGATCCCCTTGATTAAATGCTCAACGAGACGCGTGACGAGCACATCGGATGCCATCACT
CCCAGCGACCCAACACAGGCCGTCGCGCGCTTGCGGACCAATGCAGACGGGTCGCTCAGCTGCACCATCAGCAGGTTCATAATGGTTTCGTGCTCGGTCG
CAATGTCGCGACCGAACCGCCGCAGTAGATCCGTCAGGATATCCAGCGTTTCCGCCTTCACCGCCGGATCCTTGTCCTTGCCCAACCCGGCCAGCAGCCG
CGAACACACATTGGTCGCGACAGCAGCGCCCGTCGCTTGCGAGACGTCGGACACGATGGTCTTCAGCCCAATCGAGTAAATGTCGCGCAGCTCAGGCTTG
CCGTTCAAGATGAGGTCGCACAGCTTGGCACTGATGTCGGCCACCTGCGAGACCTGCACCTTCGTGACCAGGATGCCCAAGCTGGATAACATAGTGCCCA
CAGACTGCCGGTTAGATCCACATCATAAGGTTGAGTTGGCAATCCACCACAGACCATCTCACGGCGATCGACTGCACGTCGTTCGACTTGTCGTCCAGCT
GCTTCAAGACGGCGGCGCACACTCTGCATTGCCAGAACATGTGAATATCCTCCCCCCACATCTTCACGAACACCCAGATACTCACTTCGGCTCTAGGTAC
GGCCCCAGCTCCGCGTTCTTGTTGAGCTCCGTGCACAGATCCGATGTGGCCATGTACCGCTCATCCTTGTCGAAATCCGTCGTCTAATTCAGCAGCGACC
AAAGCAGCACAACGCCAGTCGGTCAGCACACAGCGCAGCGACACACGGACCGCCAGACGACCGATGCCAATAGCACCCACCTTGTCCAGCAGCTGCGCGA
TCTTCTCCTCGTTCCCGTGCATCTTGGTCAAGTTTTGCTCGCTGCAAAAGGGAAACTGGGAGATTGGGTTGGGTCCATGTTCCCGCCCGTGCATGAGGTC
ATGGACTTTATTCTAGGACAAGATGCGCATCCCACAGTTAGTACACTAAATGAGTGATTAGGCGACCAGCACTCTCTCTCACTCTCGATGGCACCTTCAA
CATACGTCTCTTCGCGACACTGCCGCCTCCAACCCAGACAGCCGCTCGTAAATACAAGCGCTATCGGGTGTTGGCGTCGTCCGAGGGATTGCCGCAAGAG
CAGATGAGTACGCCCTCGCTTCCTCGTTGTCATATTTTTGATATCAGTGCTATTCACTCACTATGACCGCCACTCAGGCGACGATGCCGTCGAAAACGAG
CAGCTGGCGAGCCTCGTCACGGGCGAGATCGACCGCCAGCTCAAGGAGCGGAACGATGTGCTGGACGGGATGAAGGCGCAGATGTCCAAGGTGATCAAGG
AGTTCGAGGATCTGACGACCAACCTCTCGGCCAAGCGTTCATGGATGCGCAGCGTGAGCAAGGCCGGCGACACGAGTCCGACGAACACGAGCGGTCTTCT
CCCGATTGTCACGACGTCCGATGTTTCCCCGTCCACATCCCCATCGCGACTCCCCAAGTGAGTACCCCCGCACTTTTGGAAACGACTGCCCTCACATTTG
TCGCTCTCTCTCTCTCGGTAGACTCGGCGGGTTCAACAAGAAGCGCAAGAAGCTGCAGCTCCAGCTGCCCTCTCCCGATGGAGCGTTTGACGCTCGCAGT
CCCGACGGCAAGATCGTTTTCGGTCGGTTGTGTGCTTGCGCTTTCGAACGATAGTACCATGCTCTGACAAGCGCTGTGCGTGGTTGTCCGTCGATGCAGA
CAAGAAGCTGCCTCGCGTCGCGAACATGGAGAAGCGAGCGGACGTAGTGCAGGCCATGCTGGCGTCGCAGCAGAGGCAACTGGCCTACGAGAAGGCTCTT
GTGCGTTTCCCGCTCTGCCGAAGCAGTATTTTCGCGCCGAGCATCTACGACGACGCGCCGCTGACTGCCAACGATCCGCCCAAGGCCTCGCTGCAGCTTG
ACTTCATTTATGGATTCCACAACGGCGCGGCTCCGAACGGCGTCCAGATTGGGAACACGAACTTCCAGTCGAGCTCAGCCGGCAACGCGGTGTATTTGTC
ATCCGGTGAGATCCTATGGTACTCCACGACGATCGTCATCCTCTTCTCCAAGGAAACGAACACGCAGCGGTACTTTTGTGAGCACACGAACGAAGTCACG
AGCGTCGGCGTGCATCCGAACCGGTACGTCGTTGCGACTGGGCAGGCTGGTCGAGAAGCCTTCCTGCTCGTGTGGAACACCAGAGACCAGCAGCTCGGTC
GGCGATTCGCGTGCCTCAAGGGCCACCGCGTCGCAGTGCGCTGCATCAACTTCTCTCACGACGGCAAGCTGGTGGTGTCGCTGGGCGGCGACATGTACAA
CACAATCTGCGTTCACGACTGGAAGGAGCAGACGCTGCTCTCTACCGCGCGAGGCCACAGCTTTCGTGTCCACATGGTAGCGTTCAACCCGTATCAAGCT
TACGGTCGTCCGGAAACGCGTCGAGAAAAGAAGCCGGGGCAAGCACTAGATGACGACGATGTTTGCTACACGCTGGTGAGCTGCGGGGTTCGCCACATTC
GCTTTTGGACGCTGACCAAGACCGATTACGAACCCCCGATCACTGAAACGAGCGAAGACAGCGTGTTTTACGGCACGTCGTTTGGTGGTCCGTCGCCACG
GCGGCCACCAACGCTGCACGGCAAGGTTTGGAAGCTCGAAGGCAATGTGCCGTCTTTCCACGGACGGTTGGATGTTCAAGATTTCACCAGCGTCACATTC
GTGGACGATTCCCCGCCGTTTTACCTGTACAACAAGGAGAGAGAGGAGTTGGTGGCCACTAGAACGCGTGATCACTCGCTCGGTCGCATCGTGGCCGGAT
CAATCGCCGGCGACTTGTGTCTGTTCTGGCAGCCGAGGAAGAGTCCGCCAGAAGACTCGATACCCGAGAACAAACGAGCGACGGAGCCGGCCAAGTGGTG
GGAAATCCCTGACGAGTACTCGGACGCAGACATCAACGAACTCGTGCTGGAGAAGATTGCATTCGAGCCGTCCGCCAGGCTCGTGGACGTGGCGCCGCAC
GACATGGACACAGGTAACCGATTCAAGCTTTCCAAGCAGATGCTGGCCGAAATCGATGGCATCAAGAAGCAGATCGCGATGAAACCCAACATTGCGTCGC
TCAACTCGCGTCTGCAGGAGCTCAAGTACGGCGGCTCTTTAGCGCATCAAGGAGCAGTGTGCCAAGTCTCCTACTGCAGAAAGACCAACCTAGTGATGTC
GTGCGGAGCTGATGGACGACTACTGCTCTGGAGGTGCCAATTGAGCAAGCCTATGCGAGTCCCTGGTGTCAACACGCACGGAGTATTCACCCCACTGGAT
GGGAGCTTTGCTGAAGGCTCGCATGCGCTTGCCGCAGTCATGAATGCAGATGGAGACACACAACTCGTGTTCCAGTTACCGGCTGTGCTGCCCTGCGAAG
GTGGGTCCTCACCTCCGACCAGCAGCACATCTAGCCCCAAACCGACAAGTATCGCCTGGAAGGAGGACGGCACATGTGTGCTCGTTGGAACCAGCACCAA
CTGTTTGTGGGAGCTGGACATCACCACCGGTGCGTGGCAGCTCGTGTTTGAGGCCCGGAGTGGAGCCATCACCGCGTGCGCTTGCCATCCGACACTAGCT
GAGGTAGCAACGTTGTCTCAAGATGGCTACCTGTGCACTTGGGATCTCCAGTCGCACCGCTGCAACCGCCGCTTCTACCTGAGCAGCGTTCTCAGCACGG
GTACGAAGGCCGTGTGCGTGGAGATCCACCCACTCGGAGACGAGATCGCTATAGGTCTCAGCTCTGGAGAGCTTCTCATCGTCGACTACAAGAGGTGGAA
GGTGCTGTTCAAGAAGGTGATCACCTCTCGGCCGGGAGCCGCTGGTGTCACTGATGCCCAGGCGAACCACGCTCTCGCCCAAGTCAAGTATTCTCCCAAC
GCAAAGTTCCTGGCCGTTGGCTCCAAGGACACGTTCGTCTATATCTACGACGTTCCAAGCGGCTACAAGAAGCTGAGCGTGTGCGATGGCCACTCGAGCG
CGCTGATGCACCTCACTTGGAGCGCAGACGGAACCATGCTTCTCAGTAACACAACGGACGGCGAGGTGCTGTACTGGTCGATCTCGCCGACCAAAGGCGA
GTCCAAGCAGATCACAGACACATTCAGTATCCGCGACACTCAGTGGGCGAAGTGGTCTTGCGCGTTCGGGTGGTCAACGCCGGGAATCTGGTCGGAAGAC
ATGACGAACGCGATGGATGTTGCAGCAATCACCACGACATCTCAACAAGGCGGCAAATCGCCGAAGTTCGGTCAAGGCGAAGACTTGCTTGCAGCCGCCT
GCAAAACCTCTATCCAGCTCTTCAAGTGGCCCGTGCCACGTGGCTCTAGAGCGAGGACGTTCGCGGTGCATTCATCGCTAATTGCAGGGTTGTCGTTCTC
AGCGGATGGCCAGTATCTGCTTTCTGCTGGCGGGGACGACGCGACTCTCATTCAGTGGACAGTGGCATCACAATCTGGCCCTTCGAACTCGAGTTTATCC
CCAGCGCTGTCGCCTTCGCTCTCGCCAAGAAAGCCAACGATCGATTTGGAGCTGGCTCTTGATATCGATGCTGGCGATGGGGACACTGGTCTTGGCTCAG
CCACTACCCCGCAGCCCACACCACCAGCTGAAAAATCGCAGCATGGACAACGGTCGCCGAGACAGCAAGCACGGGTCCGCCGCGAGCGGCAGGGATCAGA
CGTAGACACACCGACCATCCTGCCATCGGTGGCGGAATCAACCGACTCGCCATTCGTGACAAGCTTGAACAACTCCAGATCGGCTTTCGATCTTCATGAT
AATTCTACCGAGCAAATGGTTGACGAAGAAGGCAACAGCGAGGCGGCTGGCGAAGAAGACGCAGCTGAAGATGATCAAGGCGTCGACGAAGCTTTTGGCA
GCTTGTCCCCATCTACCGCGCGGCCTGAACCAACGCACGTTCGCGTCAAGCACGCCTTCGACGCGCAAAATGCAGACGAGCTGAGTCTCCAAAGCGGCGA
GCTCATCCGCGTGCTGTCCCGCAACAACCGCGAGTGGTGGCTCGGCGAGGCGTGCGACGGACGGCAAGGTATCTTCCCGGCCGACTTTGTCACGCCAGTG
GAT