Description :
From Genome Similarity Track
Location :
Scaffold_633:185- 1755
Transcript NameFunction/comments
Phyke_g10534hypothetical protein PHYSODRAFT_340492

Sequence
1570 bases(100 bases per row)
ATTCGTAGTGCTGCGCCGGGCAATGCTCAGTCAGCATCATTGGACAAACCGCCTCCTTTTCCCGTGCAAACATCATGATAGCATAATGTGATGTGAATCC
CGGTAGTGCAGCGTCAAGAAAAGGCAGTAAGATTTTTACTAAGAGATTTAGAGAGAGTGCCGACAATCCCAGGGAGATAATATCTGGATAGTACGCTGCA
CGCCTGGATTGACCCATCGGAGTCGATTACTGTCAATCGGTGACCCGTGTTGCTTACCAACTCATAGTCCTCACAATGCTTTTAGTGTGTTGCGCCTTCT
CTCTCAAGAGCAACGCCGACCCGCCAGTTTCTCCCGGCCATTTCCGACCCAGATTGTGACTCGATTACGCCGCTCCGCTCTCACGATGGTCAACTCGtct
tttcttttctttttggGCTGCTATGCACGATCACTCAATACGATGTTATTCCAAGAACTTCCAGCTAAAATTTCTCTGACGCTTTGCGCGAGAATTTGAC
CTGCTCGTGTAGCAAGAGAGTCGATTCGGGCATATACGGTAGTAACAATTTCCAGATTGCACATAACTCCTAGGAAGTGTGCTGGCCGAACTAACAAACT
CGACGTGATATATTTCCCAATCCATTAGCCCCTTTAAATGTGCCAGTACGTCGCGCATTGGGGTCTGTAGTTAGTCTAGGTAGGTGCCAATACCACAGGT
GTCAAACCGTGTGCGGTCAAGGTACGATGCCTCTTGATCCAGGAGTCTTGAACGAGATAAGTTTTGCTTGACTGGTATGGTAAGgccacttgttcttgag
aaAGCAGATTGAATTCCGAATCATTATGAGGACCCTCAGTTTGCTGCCTACCTGCTCACTGCTCCTAAGAGCTCCCTGTAGCTCCTCGTACTCACCTATG
GCGTCGTGACGAAGTCACTTGATCCTCAACGCCTCTGCATCCATCACACGCACAAGACCTGCCTCACTTCCGTAGTCCCCGGATATGTAGACTGGATAGC
TAAACGCGAACAGTTCACATGCCAGTTGTGTTCACAGTAGATTTATAATACAAAGTCATCAACACCGTAAGTGTTGGGTAATTCGCGCTCCCCGCAGCAC
CTCATTTGGGATCCAGTGATACAACTAGTGTATGGCATTTATTTTTTCACACAATCAGCAGGGGCGACTGCAGGCTTCTCTCCTTCCTTTTGCGCACTCC
CCCCGTCTCAATGTTCTGTTCACTTCAGGTCCTCTTTGGCTTGCGTACTAATCAACTCCGCCTCATGTTACTGCTGTTGCGCTTGGGCTGTCCGCCCCCC
ACCAGTGCGTCTAAAGGAAGCCCCAGTTTATCTTCGAGCgagattgaagagctccCAGTCTCTGGGCGCTTCTgcaccttcaccacactCTTTGGTTGGC
GAGCCGCCTGTTGCTTGGAGTTGTTTCCTGTTCTTTTCACCTGTTTGGACGAAAAATTGAGCTTCGGTCCCAGCACTCGACCCGTTTTCAGGACTGTGCT
AttgctcgtcctcgtcgctTTTGACTGTTTGTGTGTGCCATTCAGTTTTTTTAGCTTATTCTACGAATGA