Description :
From Genome Similarity Track
Location :
contig_9:184942- 185979
Transcript NameFunction/comments
g2768.t1hypothetical protein

Sequence
1037 bases(100 bases per row)
ACCCCTCGCCGATTTCCTCGCGGAGAGGGTGGAGTGTGATGTGATAGTTCGTCAGGCTTGCACACACCTGAAAAATGGCATCGTATAGCTTCTCGCTCCA
GCGGAACTTGTCCGCGCAGATGCGCCACAGTCCGCACAATCGGCCAAACTAATTCTCAACAATCACTCGATCACTCGAAATTGTGTCGTTCGTGGCCTGC
TCGTCTGGTGCAAGGTTGTTTCCCTTTTTCGGGTGGATACATCGGACGTGCTGCGCCAGTCCTTGGTAGCCTTTGTCTGCCAACACCGCCCATTCCTCCG
GGAATTCAACTCGTAGCTGCCCGCCGTCGGGAGCCGATGCTCGCCTTCACCTTTGCGTCGGGCCGAGAGGTGAAACGACTGATTTCCCAAGAATATTGTG
ATGTCTGAGGTGTTGCCACGAGCGTGTCTAGAGCAGTTGACCGCGAGGCCTCGTGGGTTAACTGAGACCTCCACTTTATAGCCGTATAACTTGTGCTTGG
CGCTGTACCACGGCATCGCCTCGGCCATCGAGCCGCTTAGGCGATTGGCTTGTTGAAATGTCACGTCGGTAGCATACAGAGCTGTGTCCAGCAGTGACGA
GAGAGCGCATCTCCTGCTCGTCTGCATAGCCCGCAACCCACGTATCGTACACTTGGATGTCACCACTTCCAGAAAGCCCAAGATGGTCTTTATGAACGAT
GGTGTCTTCACTTGGAAAATGTTAGAGAGCATCTCCCACGTGCCGCCACACTTCATGACCACCAGCAACATAAAGAACACGTCCTTGCCAGCGAATTGCG
ACCGCTTCCCCCGCCCAACATTCCAGTAGCGAACCACATGCGAGCGCACTGATGCCCACAGAATAGTGATCTCTCTAGGCGAAAAGTTGCACAGACGAAG
GATGGCTTCTGCCCCGCCGGCACGATAGATGCCCTCCAAGATGGGACACGAGGAGGCGACCTCGATGTTGGCTTCGCTGAAATCCGTGGAGAATTGATTG
AGCTCCGCCTGACGCTCATTTTCCCGGTCCTCGAGCA