Description :
From Genome Similarity Track
Location :
Scaffold_26:184930- 186575
Transcript NameFunction/comments
Phyin_T30-4PITG_12342Sulfite oxidase%2C putative
Phyin_T30-4PITG_12343Putative uncharacterized protein

Sequence
1645 bases(100 bases per row)
CGCCACGTCTTCTTCTCTTAAGTTGCCAATCCGCAACTTCTCCAATATCTTGTGTACGTCTGCGTGGTTATGAGCAGCATATAGCTGCCAGAACGGCTCG
ATGGAGCTGCCCGCGGCCAATAGAATCTTGGTGCCGCCAGGGTGCGACGCGATGAATTTGGTGATGTCGTACACGCCGTATTTGTAGACGACCCACGTGC
CGTTCTTATGCGCCCCCGTGTGCTGCTGCACTTCGTCGAATGAGAACGTCGGCAGGTCAGAGCGCACTTTCCCCGGAGTCACGGGAGCTTCCTTCTCTTC
GGTTAGCTGTTCGCATAGCGCAGTGGACGCAGTTAGACCCGCAGTGAACGCTCCGATGACGCCCAGTTTCCAGGAAGTTATAGGTCTTTGTTGGTGATGA
CTTCGTTGAGTGTACGCGGCTTGAAGTGGGGATCCAGTTGATGCATGGAAAGAGCGAGGGAGGCGCCGAAGCGCGGTCTTCAGGTGTGCGGCGAGCATGG
TTCGGTAGCCAACTGGTGACGAGCAGGCGCGTGTGGCGAAAGCATAATCGCCGGTCCGGATTTTAGATCACATAGAAGCAGATAACCTTCAATATTAGCA
ACGAGCCCCTGTTTTATAATTTAAAAAACATATTTAGAAACTGTTATGCCTGGAAAACTTATACTAATCTCATTTTAGTGCAGAGTAATCAATTGTGGCA
GAAGCCAGTGGCAGAATATGCCTCGCCACCGAACTACCATCATTCCCTCGCGTGTCGGCCACACATACGTCAGTACATGTACATGTATAACAGATTCCTG
TACTTGTAACAGATCATTTCCTCTTTCACCCCCTGCATCAAAAGATGCCCGAGACTTCCACCACTTTGGCTGCTGTGTCCACCGCCGCGAGCGTCGGTCT
CGCGCTCTACGTGCTCAAGCTGCGCGCGGATATTGCCGCCTCTGCTAATGGCACGAAGACGGTCAAGACCGTTTCTAAAACGACTGTGCGCAATGCAAAT
GGTGGCAAACTCTGGACCGCTGAGGAGCTAATCGCCGAACGCCGCAGTATCTTCCCGCCAGACTATGACGGCAACAAGCAGGTGCCTCGTGAGGTGCTGA
ACAAGATGTTGGCAGCTGCTAACTGGGCCCCCACACACGGCAAGACGGAGCCTTGGCGCTTCGTGGTGTTCGAGGCGCCCGAGAAGCGTCTGGAGGTTGG
CCAACTCATGGCTGATTGGTACAAAACCCACGTGCCGGCGGACAAGTTCCTAGAGTCTAAATACAAGAAGATGATCTTCAACTGCACAGCCTCATCGCAC
GTCATCGCTATCTGCATGAAGCGCCAGAAGAGCGGCAAGATCCCCGAGTGGGAGGAGATGTGCGCGGTGGCCTGTGCCGTGCAGAACATGCACTTGATGG
CCACTGCACACAACGTCGCGGCGTACTGGAGCTCGGGTCCGCCTATTACGCTGGCGCAGGAGATGAAGGACCATCTGAAGTTGGAGGAGGCTGACAAGTG
CCTCGGACTCTTCTACGTCGGCGTGCCGAAGGAAGACACAAAGACCCCCAAGGTTGCTCGAAAGCCCATCGAGAACAAGGTCACATGGGTGTCGGCGTAA
GTTAATTTGTCGTTTTCCACGTTAAGAACTCAATAAAGTGTGAAC