Description :
From Genome Similarity Track
Location :
Scaffold_13:184909- 185920
Sequence
1011 bases(100 bases per row)
TGGGGTGACCCACGGCGAGAAGTGCCGGAACCCGTGGGTGGCGAGCGTTGTTCACGAAGAACGGCGTCATACCCGTCGAGGAGTGCTCGGCGTTGTTGAG
TGCGAACTCGGCTAGCGGTAGGAACGGGCTCCAGCTCGTGACGAAGTCGCATAGATGCGGAGAACGCCTTCAAGGCCTCTCGGTTTACGCGTTCTGTTTG
TCCATCCTTCTCCGGATGTGCCACAGTCGACATCAGCAATTTGGTTCCCAAGAGCTCGAAAAGGCGTGACCAGAATGCGGATGTAAACCGCGGGTCGCGG
TCGGACACGATAGACTCCGGCAGACCGTGGTGACGAAAAATCACGTCGACGAAGTGAGCCGCGGACTCTTCCGCGGTGATTGAGGCTGCCGCCGGAACGA
GATGGACCATCTTGCTGAAACGATCGACAAACACAAGTAGACCCGTGCGCCCGGCTGTATCGGGCGGAATACCGAAGATGAAGTCCATCGAAATGGAGCG
CCAAGCTTCCGTGGCAACCGGAAGAGGGCGCAATGGATCCTGAGACGTCGGAGACGGTTTGACTCGCTGGCAAGTTTCACATGTACAGACCCACTTGCGT
ACCCACTTGTACATGTGCGGCCAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCAGTCGGGGCGTCATGGTACTCGT
GGATTATGCTCGCACGTAGATCAGCGTCGTTTGGGACGACGACTCGAGATCCCATCGAACCTGTCGATGCTGTACTTCAGCAGATTGTCGTCTAGTCGAT
ATCGATCGATCTGATTACGCGTGGTCCTTGACAGGTCACTTAGCGTGTCACTACTAGGAGCGCGCAGGTGCTTCATGATGGCACCGTATATAGGATCATC
ATCGTAAGCTGGAGCAATCTCGTCGCCCAGCGGGAGCGTGGGCGTAATCAGCGTCAAGTTGATGCCTGACGACATGCAGACCGCACAATTGTCGTCGCCC
TCATCAGCCAC