Description :
From Genome Similarity Track
Location :
Scaffold_632:1849- 4670
Sequence
2821 bases(100 bases per row)
CTGGGAGACAGGCTTGTCTCGGTATCAGTAACTCATTCAACCGATTAAGCGTCATGAGATTGTTTTGTTCCTGGTCTGATACCACGGCGCCCCTCTTCTC
CTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCTGGTTCCAGTCCCGTTTCATATGTAGAAATTCGTGCTTTGGCCATGATCGGAGTTTCTCCATT
GCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACAATCAATTTCGCCCCGCATCTGTCTGATCACCAAGTTCGAGTCACCACAAAAGATCGCCCACC
CTTTAGCCTGATTAGCCAGTAAATCAAACCAAGCAATAGCCCACGGTATTCCGCTTCATTTATTGTCAAATTCTCTGCAAACTCGGAAATAGCAGCCACG
ATCGTCCACTCAGGTAACTTCCATAATATCGCACTGTAGGCGACGCCCTTGTTCTTTACCCTAGCCGATCCATCAAAAATGAACACCAGGGTTCGTCTGC
TTCGACCGTGGGTGGTAGTATGCTTATGGTTTGCCGTGGCTGTTTTCTTGGATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCCTGGTATTTGAGCCAGGAATGTGTCGGACCCATCTCGTGAATCGTGAATCGCGATCTCGATCTGATTCGGTGTCTGA
TACAAATAGCTGAACATATTTGTCTCGGCTGATCTCATAAAAATCCGTTTCCCGCAGCTCATAGAGCACAGAAGAATATATCGCAAAGTCTTCAATGAAG
CGACTGTAGTAATTTAGGATTCCCAAGAATGGCTGCATTGATCGCAGAGTTCGAGGAAAGGGAATATTCATAATTGAATCTTAATCCGTGGAGTGGGCTT
CCGTTTCCTCGAGCAAAACTTGATGGCTTTTGTAGTCGACCTTGCGACGCCCCTAGAAAATTTTGGCTACACTGATCGATAAGTTTCATCTATCACACAC
TTCCAACAGCCGTTCCACCCTTTCATATAGGGAAGTCCATGACGTAGCAGGTATCAAGATGTCGTCGGTATACGATCTTCGACCTAAGACCGACGGTCTA
GGGGTTATATCCAGCACTCCGTCAGTGAACACATCGGTTAGCGTAGATGAAGGTGTTGTACTCGAGTTAGATTTTGGGCCGATCTTCAGATACCCATATA
GTGCAATTTCGATCAGTTGCTGGTAGATCTGGGGAGCGTTTTTCAACCCAAAAGGCATTCGTAAACATTCAAACAAACCCGAAGGTGTGACGAAAGCGTA
AATAGCTTTTGCTCGTTCTGTCATCTCCACCACCCAAAATTCACTCGCCAGATTCAAAGAGCAATACCACATCGCTTTATCCAGGTCTTGGAGTAATTCG
CTAACCAGTGGCATGTGATATATTATCAATCTTGTCAACTAGTTTACCTTTCTGTAATCAATGCATAGTCGTATATCTTCCCCATTTTTCTTGATGATCG
CCACAATAGGGGAAGCCCAAGGTGAGGTGGATGGTTGAATGATCTTGGCCGATAGTAGTCCCTTGATCAGATCTGCCAGTTTCTCTGGATATTTGGGTTC
CACTGGCCGTACTCTCTGCGCTATCGGTTTAGCACTGCTGACATCAATATCGCATACCACTCCACGCGCAGCTGGAGGCAGGGCATTCCTCTTCCCTATG
AGTAAATGGCGATTCTTCCAGATCAGTTGTTGCAACTTCTCTTGATCATCTGTCAGTGGTTTACCTGGGTCGCCGAATTGGATGTCTTCGATAGCCACCT
CTACCGTGGGAGCGACTATTTCTGGCAAGATTGCCATATGTTGGTCCACGTTTTCGGCGAATAGGTCAACCGTGTCATGGCGATATACCGCAGTTTTCGT
CGGATTGGTATCTGCTGAGTC