Description :
From Genome Similarity Track
Location :
Scaffold_307:18489- 19789
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_307-snap-gene-0.20Rough Deal homolog, centromere/kinetochore protein

Sequence
1300 bases(100 bases per row)
GCGCTTCGACGTAAACTAGGGCAGGATAGCTGTCATCAATCTGATAGTGCCGGGTAAACTCTTGGATCGAGTAATAGTCATAGCTGCTTTTTGTCAGCAG
TGTCGGGACCAGCGTCCGGATGTAGTTTAAATCACGACGCTCACTCTGGAATGCCTTGTGATCACACTCAATGTCGAGTAGCTTGAGGAAGTGCCACCAT
CGCGCATTGCCTTCAAGCTCTACACACTGATGCAGAAAGGCGATTTGCTGCCAGGCTCGAGCGGCATCAGCTCCTATCTTCGCTAACTGTTGGAATCGGT
TGAAATCCTTCGCGACATTCTCTCTTGATATTTGGCGCCTAAAGGCATTGAACGCCTCGCGTTGTTCCATAGTgAGCATCAAACCGAGTGCAAGGAAATT
GTCAATCTGCTCGGATTGGAATACTGTCGaTAAAAGTTTTCCAACTTGTGATTGGATCACATTAAGTGCATCTTCAGGAACCCAGCGCATCGATAAAATC
ACCTGGAGGCTCAATAAGTCGGCATTGTTTTCCACAAGAAATGACACAAAACGCTTTGATGGGAGAAGCTCGTGCCcTGGTATCGTCGCCGCAGCATCGC
CGACGCCCATAGCTTTCGTATCACCGTATGTAACAAGAAGGCGGTGTTCGGCAATCGCAAACCGGGTAgCAAATGCCATCGTCTGTGCACTGGGTAAGAC
ACACATCGAGTCTTCTCGGAACCATCGACTATAGATGCGCCATTGGTCACCATCGACCTTAAGGGAGTGACCGAAACTCAGCTCACTCAGCTGGGTGAAA
TGCAAAaCATCTTTCAGCAGAGTCGCTCCTTTAAGAAGTACCAAAGTCTCCTCCAGAGATGACGCATCGCAAACACAGACTGCGTATCGCAGCAACTCGA
GTGCATACCTGGGGGCTTGCATCCTCGCAATCTGCGTCGGAGTAAGCGTACGGTGCTCCTGCCCCTGCGTCACGAGGTTGTAGATCTCTTCAGTATGTGT
TGCAGTAAACTTTGAGATTGAGAGAGAGATGTTTTTGAGGGCGTGACCTGATCCTTGTTCACTGGTGCCGAGTGAACCGTCACCATCTCTGAACACGGCA
TCGCCACGTCGACGTGAGAACAGGTCTCGTGAGTATTGAACTGCCTTCAATATATCTCCATGCTCAGCTGCCACTTGCGCAACAATAGAGTGATAGTCAT
CGCTAGACATTCCCATGTGCGATGCATAACGCTGCAGGTCGAATGCCAGCTTGGTCTTGTGTTCATCTTGCTTTTCGTCTTTAATGTTTGGTATACCCGA