Description :
From Genome Similarity Track
Location :
Scaffold_1:1848712- 1850664
Transcript NameFunction/comments
g576.t1hypothetical protein
g577.t1AGC65357.1 OCM1, partial [Phytophthora lateralis

Sequence
1952 bases(100 bases per row)
GGCAATCTTTGTAGAGGTGCCAGCCGTGTCGTCCAGGATTTGAATTGCGTTCGTGATGTACGACTCACCGTGATAGTCAAATAGCCGAAGACGAACGAAG
TTTTCTGGTGGTCCACTTGCAGAGTCGGCTGTCCAAGTACCGGTAGTGTACACATGAAGCGCGAAGGTTTTGAAGGTAGCTGCACCAACCGCCAGGAACA
TCGGATCCACACCAACCTTGCAGCTACGCAGCGAGCAGTCAGGCCCATGATACCCTGGGTCACAGCGACAACCATAGCTGACGCGGCTATCCCAGAGGTC
ATAGGTAATTTGATCCACATTCTGTGGGTTTCCAAAGAGCGTGCCAGGAGTCTTGAGGCCTAGCTCGCGAAGACTTTCACACGTTCCGTGGCCGGTGCAC
TTGTTAGGACATGCCGACCGCTGACACGCGCCACCTTCGTATCCGTCAAAGCACGTGCAGACGCCCAACGTTCGATCACACAGTCCCTTGTTGGCACACT
CCATGTAGAAATGAGCCTCGCTGGTCGCAGCGTCCGGGTTGAAGTACTCGTACGTTCCTGCCGGGTCCTGCTGCGAGTCCGTGAGAATCCACGAAGGAGT
AACTCGCGACTGGTCCATGTTGATGTCGCCCTTGGGCGTGTCTGCGTGGGCGTAGCCGAATTGGCACGTGCGGTCCAAGCAGTCGTTGCCCTGGTAGTTC
TTGTAGCAGTTGCACATGTCCTTGGCCATACACGCTCCGTTGCCGGAACAGCCATTGGGACATTCCGCAGACGTCGGAACGCTCAGCAGTGCCGCGACCA
GCAGCACCAGTCCGGACGCTAGCAGCATCTTGCGTCTACCGCCCATCGTCGATCAATTGTTCACCTTCGCGTGCCTGAAGGTTTGTTACTACTTGGCGTT
GCTTTACCGAATGTCAGGCCCACAGACCCCGAACTTGCAATGTGAAGCTCGGATCGCATCCGAAGAGCCGTTAGCGACGAGTGAGCCGCGATCTTTGCTT
GAACGGGTGGTCTCGCGCCCCTCCAGCGATCAGGACGGTCTAAACACCGGTCGCCTTGCAAGGATGAACTCTTCACTGACGAAACACGAAAGCTTGGCAG
TAAAATGTCTCGAAAATAGTCTATGAATCGGGAATATCCTCAATACTTTAACGTGAAGCTGGTTTTGACTGATCGGGACAGCCTGGAACTCCAAGAATCG
GAAAGGGAACGTGAGATAGCACACTAGTCGAACATCCACGAGTTTCTTCTACAAGCACCCGCACCTATGATACGACAATTTGCTGAGTAGCGAGGAGAGC
ATGAATGCTCACGAACGCGATGACCAACATGACGATACATGATGTAGTTAGTTTGCTCTCAATGCGATGGAACTTGCAGGACTGTGGTAAACTATTTTGG
AGGGGAGCAGCAACGGAGTGCAAATAGAACTTCATCCTAATGATTGAACTGAGGATTGGATTCATCGTTTGCAGCACTAACTGTGGCCTTCATCAAATCT
GCTAGCTGTCCAAACTGCCTCGGTTCTTTCATTTTGCTGTACTACCTGTCCAACCGAACGCTGGATAGAGAAGCCTACAGCGCCAGGATGTTCTGCGTGT
CACAGTTGTCGTTGGTGTAACCCTTGAAGCAGGCGCAGATACCCGTCTCGGTGGTGCAGAGGCCGCGACCGGAGCATTGCGAGACGTATTTGTACTGGAA
CGCGTCTGCAGGCGGAGTGACCTTGTAAAAATTAGCTCCAGACGCAGACAGCGTCCCATCTGCAGAGTTACCACCGAACGGTGTGTCCAGCTCAACTTGA
TAGGCGGTCGCTGGCGAAACAGGAGCGATGATTGATTTGACGGTGAAAAACTTGTTCTCGAAGAAGATGAGGTCACCTGCCACTACCGCAGGGGCAGTAA
TCCCGACAGTAATCGTGGTATCGCCCACATTAATGGCAGCCGTGCTGGCGAT