Description :
From Genome Similarity Track
Location :
contig_59:184826- 187288
Transcript NameFunction/comments
g9001.t1casein kinase II subunit beta
g9002.t1hypothetical protein PHYSODRAFT_521596

Sequence
2462 bases(100 bases per row)
GCCGGTGTAGTACTCACTGGAGCTGTGGATCTTGTAGCCGAAGACGCGCGGCACATACGTCTGCGTCGGCGGCGCCACCACGAGGTGGGAATGCGTCATA
AGGAACACGTGCGGGAACGTCGCGCCAAAGTACGCGCCATCGATTTCTGCAAATAAAAGTCAACAACAACATGAGCCTCTCGCACGTCAACTCAGCCCCC
CCCCTCTCCATCTTGCAACGTACGGCCCGCCCGCTGCGACTTGGGGAAGAAGATGTCCCTGCACTTGGGGCAGAAAACATTGACGGTCGTGTGTCTGGGC
ACGTCCGACTGGCCAACGGGAAGCACCGGCTGCCCTTGGCAGTACACGCGATGGCAGCGGCCGAAGTCGACGTTCTGGTACTTATCAAGCATGGCGGCCA
TGCCCTTGGTGGTGAGGATGTAGCGCGCGTGGATGAGTCCGTAGAGCATCTCTGCGGCGGACTCGATCATCTCCTGCTGGATCTGCGTGAGGCTGCTGTC
GTTGGGCGTCTCGATGTCCAGGATGATGTCTAGCGCGTAGTCGTAGTAGGGACGATGCTGCTCAGGCCGTGAGGTTGAAGTCGTCCTCGATGTAGTCCTC
GTCCACCTCGCACAGAAAGCTGTTCTCGCGCAAGGAGCAGAACCACGCGATCCAAGCTCGTCTCCTCCTCGTCGCTGCCCTCCACGTCGTTGTCCTCGTC
GTCGTCATCATCGTCCTCGTCGAGCGCGCTCGAGTCCTCCTCCTCCTCGTCCTCTCATCCTCCGAGACGCTGGCAGACGCGCGAGCCGCCTCAGACACGC
GCAGCTCCTCCATGTGGCCGAACAGCCGCTCCATCTCGGCCTCCTCCGCCGTCTGCGCTGGCTGGCTCATGATGCGTCCCTTTGGCAAGGAATTGCAGGG
CCTAACGGGAGCTTTAGAGCGCTGCGAGAGCCGCGTTGCACTCGCTCGCGTCTCTGGATCGCTCCTCTGGCACGAGAAGAGCGCGAAAGGGGATGCACGC
ACAGATACACTGCGCTGCTCTAGTCGCACGCAACCTGCACAAAGGTCCGCCGTCGCTTTCTTCCCGATTAGAGCCAAGCGCTGGCTTGGAGGCGGTCGGA
TTGAGGGTACCGCTTTCAAGGTACATTGTGTGGAATACGTAAACTCTAGCCATTTTGGCTTCATACATTGTAGCCATTTCTACAATGGCCGCAGCGGACA
GTTCCTCGACGACTTGGTACGAGGCCTACGCGTCTGGGGATGAAGCACGGCGAGTGGATGGAGAGGAAGACGGAGAGGAAGAGTATGAGGAGGTGGAGGT
AGAGGAGATGACGGATGACGAGCCCATGCACATCACGGGGCGTCTGTTCCTCGGCTCCATCGACGCCGCCAGGAACATCAGTGCACTGAAGCGACTGCGC
ATTGGGGCTGCGCTTGCGTTGCTGGGGAAAGGGGAAGAGGGCGCAGCAGTGCCGAGCCACACAAGTACAGTCGCCGAAGTGTACGCGGAGTTGCAGATTG
CGAGGAAAATCGTTGAGATTGAGGACTCGAAGGACGGGGACTTGCTGCGGAGACTGCCTCGGATCTTGGCTGCATTGAAGAAGCTTGTGTGAGGAGCTGG
ATTAGATGTGTTGCTGTAGTATTGTACAGATGGCGGGCTGACGTTGTCGTGCGCTTGGATGCTGGCTGAACAGGGAGAAAGTCGAACATGAGAGCAAGAG
CGTGTTGGTGCATTGGTACGTTTGTCACTGAGCTAAACACAATCACTTGCGTTACGTTTTCGTATTAGATGGACATACTCACGGACTTGATTGCCTTTTT
CAAACTGCAGCATCGCTGGTAGATCACGCTCTGCCGCTGTTGTGGCAGCGTGGATGCTCGTCAACAGCTCGGAGCGACAAAGTGTTCAAGATTGTGTCGA
TCAGATCAGGTGAGAATGCGTGGTGAAATGATTACAGTTCTTTGCAACTGTACGCAGACATTGGCCTAACAGAACTTCGCATTCGTCCCAGGATCATCCG
TCCGTGGATTGAGATCAATCCGCATTTCATACGAGACCTGCATCTGTTCCAGGCCATCCTGGCTTCGACCCATGGGGCATTACTGAGTTCGGAGAAAACT
GCGTTGCTAAAGGATCGATCTTTCCCGCGATTGGACTTCGGTGCGAACCTCGTCGAAGGTGTTCTCCAAGGCACGAAGACGATCACGATGCGCTTCTTGT
CCGATGTCGAAAGTGATCACAATTCGGACTTGAAGGACATCCACCTGTTCTCGCTTGTTGCAGCAACGACCTCAAGCACAGATGACACCTCGATGCGGCC
GCAGTTCGCTTACCTGCGGATAGACCAGATCGAAACCAAGGAGCTGAGCGGCATCGACGACACTACGCTCCACAAATCTGGATTTGCGTCAACCGATGAG
GTGATGGCAGTTCTGAAGCAGTTCTACCCGAACGTGACCGCCACGACCCCATTGCTGATGCT