Description :
From Genome Similarity Track
Location :
Scaffold_459:1848- 6185
Transcript NameFunction/comments
g14460.t1hypothetical protein

Sequence
4337 bases(100 bases per row)
GTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGACCTCGACGTAACCCTTGATATGGCC
ACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAT
TCTAGATAGAAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCCTATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTG
CCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCATGTCGGGATTTAAGTTC
CGCATCATGATGATCGACATCCCCTTTTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCC
CGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGTACTATCGCGTT
CGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCT
CGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCA
GATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAAC
ACGCATGTTCTCTGTCAGACGCACCTTAAGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCACC
ACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTG
CCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCAGTGACCTGGGATCGCTTGTTGATGTTGCA
AGTAGATTCGCCGTCTATCTTCAAGGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCG
ATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGC
CTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTGAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGA
CGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCT
TGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCC
TGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCG
CAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATAC
GTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCAC
GCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGAAATTCCTTGGGTATATC
CTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACA
CGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGT
CGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCG
AACTGCCTCGACAGTTAGCACATCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATG
TGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCTCTGCCCTTCCATACCAGGACGCCTT
CAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTT
CATGCAAGCGCATGACGGGTTTCCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGC
TCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAA
ACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAAT
ATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTG
CCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTT
GGTTGAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAG
CTGAATTGTTCCTTCGTTCAGCAGTGCATCCTGAAGCCCTCTGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGC
TCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGA
CATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAG
AGGATACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTG
CCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGA
CGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGC
CACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGTCCGTGCGCT
CTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCT
TGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAAC
GCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCGCCAG
GCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGT