Description :
From Genome Similarity Track
Location :
Scaffold_1405:1848- 4708
Sequence
2860 bases(100 bases per row)
TACCTGATTACCAAATTTGAGTCCCCACAAATCACCAGCCGTTTTAGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGCCCGTTATACTCCGCTT
CATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGAAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCG
TACACGAGCGGATCCATCGAAACTCAGGGCGTACAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGA
GCGATTCTGGTCAACGCCTCATCCATCTTAGCTCAAGGAGTAATGCTCGTAGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCT
CCAGTGTCCAAGGGGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGAT
CCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGC
TTCAGTGTTCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATAACCG
TAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTC
TGCCTTTTCCATGTTCCGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGC
GTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTAAAGTGGTCATCGCAGCGAAATCTA
CCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAA
CGACTGTGGGAAGGACAAGTCTGCTAACGACGACAGGTCCTTAGGATTCGCCTCCAATTTCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGC
ATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTTTCGCACAACTGATCCCACGATTTCG
CCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATG
ATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCGATAGAGGGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAAT
CCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGGGTGATGAATGCGGAAAATTTTCCGAGCTCCCCCCGCTCCATTCGCCATAGTAACCACCCAG
AAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCA
GACCGTTAACCAGCCGGTAATCAATGCACAGACATATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACT
GATGATCTTGGCTTGCAGTAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCG
CCGACATTGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGAC
GATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCC
TTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGC
CCTCTCTCGCCTGGCAGTCCTTCTGTCTTCGGGGGACCAGGTACCCTGATATCAGGGAAAACAACAGCTGGATCTAGTCGGTCCTCTAACGAGTTTAAAC
CCGACGGGTCTGGGTTGACTAGTGTTGCCACTCTCGATAAAGATCCAGGCACTTTATCCCATGGGAAGCTTTGGATCCACTTGTGGATCAGCGGGATCCG
GCTGTTCGGCTTTAACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTTTCTAAGGCCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCAT
TGCTTGGATCTCGACCCGTCGATCCCTCTGCCGGATCTCTCGCGGAGTTGGATATGAAGGCCAATCCGCCAAGGGGCCAGTTGGCTCCGCCGAGAGCTCC
ACTTCTCCGAGCGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAG
GGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACC
TGGCCCCTGGATTACGGTAGGTACTCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATG