Description :
From Genome Similarity Track
Location :
Scaffold_12:184791- 186909
Transcript NameFunction/comments
Albla_Nc14017030conserved hypothetical protein
Albla_Nc14017040glutamyltRNA(Gln) amidotransferase subunit A putativ

Sequence
2118 bases(100 bases per row)
GTCATGGACAAACATCGGGCACTGACACAAATAAAATTCTAGATCCGACACAGAGCGCAGCCAATGATCTGTATTCGTGTATTTCGCTGTGTAATAGGTG
ATAAAGTCACCAAATTTCAGTTCTACACTCTGCCTACTCCTTTCATCTCCCGAGTAGATACTTTCCTGTACATTTTTGATGGCGACGTCCACAACTAAAT
ATGGAAGACAATAGTATCACGAAAAAACTCTACCGAGTGCGAGGAAAGTCAATTCCTACCAGTGTCCTCGTGCTCTTCGATGCCGGGTATGTTCTGGATC
TGTATTGGGCTGAAAAGATGGTCACAATCACAGCAAGACTTGGCAAAATCTCGAAGCAGAACTGGTTTTTCTGCCGTAAAGGATAGGCCCGACGATGCGC
TCATTCGCCTATTGGGTAATGCTACAGAAAACTCGTGTGTGTATATAAAAAATCATCTTAAGTACAAATGCGCCGCAATCTCAGGTGCCCGATTACTTGT
TATTTGAATTGAAATCAATCCTATCTCAGATATACACGATGGAAGCGATATGAGCTGATTAACAGCAAATAGTATGCCAGTCCAGCTGAGTGACAACGTA
AGAGCTTGAAGGGAGAAAGTTTGTATCTCAATGTATCGTCTCCGATTTGCACCATTTAGCTAAAAAGTTATTACGTCTTTACGATATATACGTTATAAAA
ATACTCAGACGAATTGCTTGTTTGATTATCAGTGAGCTGTTGGTGATGACCCGAAAGTGCTGCCTTATCCAGCACTAGGCTTTATCGGTCACCTGCGATT
GTCCTTTCATATAACAGCTACTCCTTTATAGCCTGTAGCATCGGCGAACTTTCTAGCTTCGATAGCCTATAACAATGCATGTAACCGCGTACAGAGATGT
GTGTGCGTCTCATGCCAGTTAATTTTTTGTCCAATTGTCACGAGCACTAGTCTAAGGCTCACAATCATTTCGCATTGAAAATGTCGTCGTGGATACGACC
TTCCATGCTCAATGTGGCTCTACTTGCAGCAACTACCTCTTTATTAATGTACCTGGAGCTCGATGACATTAGTTCTTCGAAAGGTACCATTGGATTATCA
TCACAGTATGAAGCTACTTCGCTAAAGAGCCCGAGGCTTGCGGGACCAGCATTAAAGGTCGCATTTCTCTCAACGCTTTCTCCCTTTCCTAGAAGTGACT
TATTGTTCACAGGTTGTAGCTACGCTGATGGGAACTCCGGTTATTGGGCCCATAATGGCGGCTAGTTTGATGCGGGCGAATCGTTACACTGAAGTTCGCA
AGTAAGAGCAACGATCCTTTCACTTGAGTCGTTCTTATTGAGCCTCTAATCATCGCATACAGATTTGCGTCCATCCTTTAAGATCTTCCAGTACTTTACC
CATATGTTGAGCCGAAAGCCTCTCAAATTGAAAGTGCTCCAAGTAGGGTGGACCCTTTGAGCTATCTTACTTCGCCTACAAACTCGAATTCGAAAAAAGG
CGCTTTCAAATACTTGTCAATCGCGGACTACACAACCCGATATCAAAAGGGAGAAATCACTCCTTTGCAAGTTGCTGAGGCTGTTTTGGCAGCGATTGAA
GAATCCGAGGAGGGTAGTGACCCCTTAAGAATGTTCATTGCCATTAACAAAGAAGACTTCCTCGACCAAGCGAGAGAATCGACAGAGCGCTACGCTAAAG
GTGCAACGCTTGGGGTACTTGATGGGGTACCTGTAGCAGTGAAAGATGAAATAGACGTGATCGGTTATCGTACTACTCGGGGTACGATACTTCCCAAAGC
CCCTTCGCCTGCAAAGGAAGACAGTCCTTCTGTTGCCCGACTGCGAAGCGCAGCCGCAATCATTGTTGGTAAGACCAATATGCATGATATGGGTGTGGGA
GTCACTGGCCTTAATGTGCATTATGGCACCCCAAAAAATCCTCACAATGCCAGCCACTACACTGGGGGTTCATCGAGTGGTTCTGCAGCCGCAGTAGCTT
GTGGAATTGTTCCGTTAGCGCTGGCTGTCGATGGAGGCGGTTCGATACGAATCCCGGCTCCTTTCTGTGGAGTGGTTGGTTTGAAGCCAACTTTTCAACG
TGTTCCAAGCTTACCGAC