Description :
From Genome Similarity Track
Location :
Scaffold_5:184719- 186033
Sequence
1314 bases(100 bases per row)
TTTGGACTGCTGAGTGTCAGCAGGCATTCGATGCAGTCAAGCAGGGCTTGACTGATGCGCTAATCTCGGCAGTGGCGGACCAAGATCGTCCATTCGACGT
TGTATCTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCGCGAGAGCCGTGATCGTGTCGTCTACTACCAATCGCGCCAGCTGAAG
CGGGCTGAGCGCAACTACCGGTGCATGACAAGGAACGCCTGGCCATGAAGTATGCACTCGCGAAGTTCCGAGTGTACTTACTCGGAAGCAAACCGTTCGC
TGTCTATACGGACCTCGCGTCGCTGCGGACTGCTGTGAAGTCTCCGCACATCTCGCAACGGATGGCGAGATAGCTCTCGTTCTTCGCGGAGTATAACTTC
CGGGTTAAGTACAAACCCGAAAGGCTCAATGTAGTGGCCGACGCGATATCGCGTCGACCCGACTATGCTACGAATGATGCCGACGTCAATGCCATTGGTG
CCATGCGATCGAGTTCCCACGTCATCGTTGATGGACAACGTGAAGGCCGCGTACGCGCGCGACGCGGACACGAATCTCTTGCTGGCCTACGGCTCTTCGC
CTTCTGACCAAGCTCGTCAGAAGCTGCCGAAACACCTTCGTGCTAGTGCACACCGCTATCGGGTGCACGATGTGTTACTACTCTACAGTGCAGTCGCCGG
CAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGAACATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAG
AAGACATACCTTCTTCTTACGCGAGGCTTCTACTGGACCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGC
CTGCGCCCTTCGCGCAGGCTCCCTTGCAGTCACTTCTAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGATTTCGTGTTCGGTCTTCCCCCGGACAG
CCAGGGGGTACGGGCGTTGTAGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTC
TGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGGGTTTAC
ACTTCTGGGGAGTCAACTTTCGATGTCGACTGCAGACCATCCGCAGACGGACGGGCAGACCAAGCGCGTGAACTGCGTGCTCGTAGACGTGCTTAAGAGC
TACGCTCACTCGTT