Description :
From Genome Similarity Track
Location :
Scaffold_28:184716- 189557
Sequence
4841 bases(100 bases per row)
GACGCCCAGGAAACTGCATCCTCCTGCAAGATTAATGGCGTAACCGGTAATACTCTTTCGTGAATCAGGATCGTTACCCCGATTCACATTAACCATCAAG
ATGCAATGTCTTCTTGTCTTCCTCTTTCGTCCTGGTGGGGTAAACGATGCCCTGGCTTTTGGTGCCAACGAGATAGCGCAGTAATCTTTTTGCTGCACCA
AGATGCTGCTGAGTAGGAGCTTGTACATATCGACTTAGTTGACCAACAACGTAGGCAATATCTGGTCTGCTGCAAGTAGCGAGATACATCAAGGAGCCAA
TACATTCCCGGTAGGGAAAATCCTTCCCAAAGATTGGCTGTTGCTTGCGATAGACGTCTTCATCAGCAGGCAAAGTTTGGGATGTAAATCGAGTGCTAAT
TTACATAGGAATCCTGCTCTTATGAGCCTCTGCAAAATTAAAATTCGTCAGATTTGAATTGCGGTATTGCATTTGATGAATCTTCGTCGAAGTATCGTTT
CGTTTGACTTCAACACCCAAGTACTTGTTCAGCAACCCTTGGTCTTTTAGGCCGTAGCTATGATCCAGTCGCGTGAACACCTCATTTTTAAGTGCATCAT
CTTTGGTCGCACAAGGTATATCATCAACGTAGACCAACACAAGTGCGAAATCGCCGTTTCGGTTGTACACGAACAAAGAAGGCTCCGTGTTATTGCGTTT
AATCCATAACTTTTCAACCATTTGTCGAATTCAGAATTGCATTCCCAGCCTGATTGCTTTAAGCCATATAATGCCTTGTTCACCACGTAAACATATCCTT
CCTGCTCACAGGAATACCCTTCAATTCTATCCATATACTGCTTAATGGATAATTCAGCATTCAGGTACGCAGTATTGACGTCTCCTTGGTAGACTTTTAA
CCCTAGCCACACACACATTTGCAACGAACAGTGTGAATGTGAACATTCTCGCCACAGGGGAGAAGGTTTCTTGGTAATCGATGCAGTGGCGCTGCTTGTC
ACCACGTACAACTATGCGCGCTCGAAATCGGACAACATTTCCGACATGATCGGCTTTTAAGTCGAACACCTATATTGTACTTATAGTGTGTTTGCTGGAC
GGTATCCCTGACCTTGGTATCAGGTCCAGCAACTGTTTTCCTTTAGGTGTGTGGATTTCTTTGCCCAAGGGATCGGCCCAATATTTCGAGTACCTTGATT
TCATCGCTTCTTTGTAATTCCTAGGAATCGTTTTTAACATCACACGCGCGAATACCATCTGAACCGCGTATGTTTGCATTAAATGCCTTAAAAGGCGCGT
GGACTTCGTAGTCGTCAAAATAGGTTGGTGGTTTTCGTTCATGTGGTTCCCGGGGTCCTAGCCTGCGCTGAGGTTTTCTGATTTTGCAAGTTTCACATCA
ATCTTTGAGCGTTTGCGCTCCCGCGTGCGACGAACTTCGATATCTCGGGGTCGTCGACGGCCAATCATCTGTCCTGATGGGATCGCCAGTTCCTGTCATG
AAGCCGGTGTTTAAAAGGTCGAGTTCTAGATGGTTGGCAGAATGCAAAGTGAATGTATTTAGTTCCTTAGTTCGCAAACTCCTTGCTACTCTAAGCCTAC
TGGGTTCTTCAACTGCACATTTGTAATCGCTGTCGCGCATTACTAATCGTACTGTCCCGTATTAGTAATCGCACATTGCGCATTACTAATCGTACAGTCG
CGTATTAGTAATCGTACATCGCGCATTACTAATCGTACAGTCGCACATTAGTAATCGCCAGTTCGCGCATTACTAGTCGTCTAAACGTACCGTTCGTTTC
CCACTCTCTGGCCGAGGCGTCTTCTCTTCAACACTCCCACTCGACTCGGCCGCGCTTGGTGACTAGATCCCCAACTTGTTTCGGAGACCTTCAAACTGCA
CCGCGCTAATTGGATTAGTCATCAATTCAGCCTTCATGTCCTTCATCGAGCAGCATTGTAGCACCACTTGACCGACTTCGACCTTCTCCCGCACTAGGTT
ATAGCGAATATCAATGTGCTTGGGACACTTGTGGCATCCGGGTTTTTGGTCAACGCTATCGATCCTTGATTGTATTCATGAATCTTGACCGCTTCGTTGA
GTGACATCTCGCCAAACTCGCAAAGGGACGCTTTCAGCCAAATTGCTTCTTGAAAGCCTCAGTCAACGCCATTTGATCTGCTTCCGGTGACGACAGTGCA
ACCGTGCACTGCTTCTTGCTTCTCCAGATGATGCAACCGCCATTCATCATGAACGCGTAACCACTTGTGCTTCGTCGAGTGTCCACGTCACCATCCCAGT
CCGCATCCGAATATCCTTCAAGTACTTGTCGGTTCTTGGCTTGGAATTCGATGCCATCTGTCTTCGTTCCTTTTACATATCTGAAGACCTCTTGAGTGCC
TGCCAATGTGTTGAGCACGGATCCGAAGCAAACTGGCTGAGAGCTCCCACTACGGCAGCAAGATCCAGCCGGGTCCCAACCATTAGATACATGAGGCAGC
CGACAGCATTGCGATATGGGACATGGGCCATGGTCGCTTCATGGTTGCATCCTCCTTCGCACATGCTCTTGGTCAACTTGAGTCCGGGATCTTGCGGTGT
CTTGACGGGGTTGCTGTTCTCCATGCCGAACTTCTCCAGTATGTCTGCGGCAAACTTAATTTGACGAACGGAACATTGCCACTGATGAATTATTGATCAA
TCTCCGTGCCCAAGAATTACTTCAGCCGACCAAGGTCTGTCATCTCGAATCGCTCGCATAGCGCCTTCTTTTTCGTTTGGAGCATTTCGTCGTTGTTGCA
TTCGAGAACCAAATCATCGACGTAAAGAGCCACAAAAATCATGTCTTCGCCGTCCCACTTTGTGTAGAAACAGTGATCGGTCTTGTACTTCTTAAACCAC
ATCTCGAGCATGAACTTGTCAATGGTTTGATTCCATATGTGTGGGGACTGCTTCAAACCGTAGGGAGAGCGCTTGAGCTGACATACATAGTCCGGTTCAA
CTTCGTCGATGTTACCGTCGGGCTGCACCATGTAAATGTCTTCGTTGGGAAGTCCGTTGAGTAATGCTGTCTTGACGTCCATTTCGTGCACCGTCAACTT
GTATCTGGCCGACAAACTGAGCAGGATCCGAATCGACGTGAACTTGGCCACCGGAGCAAACGTTTCTTCATAGTCGACACCATACTTATGCGAAAAACCC
TTGGCCACAAGGTCGCGCCTTGAATCACTCGATTTCGCCAGCTTGATTCTCCTTGATCCGAAAGCCCCATCGACAACCGATTGCCTTGCGACCTTGTGGA
AGCGGCACTGATTCCCAAGTCTTGTTCTTGCACAACGATGCCACTTCGGAGTTCCAGGCATCCTTCCACTTGGCTGCGTTGGTTAATTTCATCGCCGACT
TTAACGTAGTTGGCAGTTCCACCACTGAATCAACAATGTATGCAGTTTCATAATCTTGAGCCGTCGCGGACATCTCATCAAGCGATCGGTGAAGACTTTG
TTTCTTGGCCCGGAAAATCTGCACTGCCTGTTCAAGCGACCGATTGCGTTGATGCCGCTTGCTGCCAGGCTCAAAGTCGACGTCAGGTGGGGCTTGAGGC
TGTGAATACTTGGTGTTGTCGAGCATGGGATCTTGATTGGACGCAGCGTCATCAGTGTATTGGTCGGTCTCATCAGTTTGGTACAAAGTTTCGTCGACCA
CCATTTTATCTTGAACGACGACTGTGCTACTCTGCTTCCCGTGATCGAAGACGTCCTCCATGAAACGAGCGTCACGACTTGTCATCACACGACGGTTCTC
AATGTCTTCGAATCGGTACGCTTTTTCATGCTTGGAATAGCCTAGATATCGGCAGCGTACCGAGAGAGCGTCAAATTTCGAGCGCTTTTGCTTAGGCACT
TGGACGTACGCATGGCAACCAAAAACTTTCAGGTTCGCAACAGGTTTTTTTTGCCAGTCCAAACTTGGTACGATGACATGTCATGACCGACCGCACGTGA
TAAACATCGGTTCCGGAGAAATATCGCAGTCATGACAGCTTCCCCCAATACGACTTCGGCAAAACAGCGTACTCCAGCATGCAGTGACCACATTCGACCA
GTGTGCGGTTCATGCGCTCGGCAATTCCATTTAGCTGAGGAGTGTAACGAAGCGTAATTTCTGTACAATGCCGCGTTCTGCACATAACTTGGCCATAAAA
CCAGAAGTATATTCCCCGCCGTTGTCACACCGAAGTGTTTTCACGCGCATGCTGGTCTGGCTTTCGGCCAACGCAACGAAGTGGGATAATTTGTCGGCTA
CCTCTAACTTTTTCTCCAGCAGGTAGGTGACACAGTAATGCGACTTCTCGTCAATGAAAGTGACGAAGTATCTCTTGCCACTGAATGTTGTGGTCTGCAT
CGGACCGCAGATGTCGCTGTGGATGGCTTCGAGTACTTCCTTGCACGATTTGGGGAATACTTCATGATGTTCATCCGCGTCTGCTTGCCGAGATCACAGC
CATCACACAGTTCCCACTTGCGCACTGATGTCAACTTGATACCAGTGCCAAAGCCTTTGGTGACGATGGTGGTAAGACCGCCATAGCCAATGTGACCTAG
TCGAAGGTGCCAGAGGTACGAAGTGGTGTCCCCATGACATTCCAACGAGCTAGTCACATTGGCTTCGTCCACCAAAAACGGCTCTATGCACAACTTGAAT
AGTCCTTTGCCTTCGCGCGCACCAAGCTTCCAACGAAGGCCATTCACTTCCGCGAAGCACCCATCTTGCGTGAACGTGACCGGGCCAACATCCTTGGTGA
AACGCCCCACGGAAAAAAAATTGCGTGACAGCTTAGGAATG