Description :
From Genome Similarity Track
Location :
Scaffold_266:18471- 23430
Sequence
4959 bases(100 bases per row)
TGGCACATCGAGTTAGACGACGCCATAAGGGCGCTTTACATCGTTGACCAGCAAGTGCAAGTCGCATTTTCTCAGTCGATCTTGGTAGGGCGTGCCAGAC
CTTAGGCATTAGGTCTCAAGTTGCACGACCCATACGTTTTTGGGTCGATAGAGGTCTTCAAAACCCGGCTCAGACAAACGTTTTAACCGCCACAGACTAA
GCTCAGGGCTCGTGTCGAGCTCCTGAAACTCAAAGAGGGTAAGCGTGATGTGGACTCTTACGCATAACACATACGACTCCTTGCGAGTTTTATTACGACC
AACCCGGTCCATAAACACACATTAATTACAGTGTCCATGCAAATTCTTGTAGATGGTCCCGTAAAGACCCACCTGTTCCGCCTGGAACTGGATACGCTTG
AAGAAGAGATCTCAGCTGCGGAACAGGAAGACTTTAGCTTAAGACAGGCTCATGCTAGTTCACTGTCATATCTTCCACCGATACGCCAAGAGGTTGAAGG
ACCAGAAACCATGGACCTCTGTTATGCAGAGAGTGAGAGACCTCACTCTTCGAGCAGTAATCGATTGCAGAAGTTCAATTGCTGTTAGAAATTAGGATAA
TACGCCTACGAATGTAGTGCCCAACGCTCAGTATCTCGCAACCATGATCGAATTTATCGATTGGAGAGCCATGATGAACAACGGAAGCGGGTTCGACGTT
GTTGAGAAGTCGCAACAATGTGGCGGGCCGTAAAAACCAGACGGGGTCCGTAGAACGGGAGAATCCTACTTATCCAGCAACCACAAGAGAATTTGCAAAC
CTATTGATGAAATTTGCTCCAGATACACAATGCTTGTGTGTCTCTGTTCCTGGTGATGAGGTATCCCTTATAGCCCTGAATTTAGATATGACGAAGGTCT
AGTCACTTCGTGCCCTAGTTAACTGTGGGGTGTCGAACAATTTTTTTCGTCGCCAGTCGCTAGAAGATCGTAGGCTCAAGTTTGTTGAGCGCAACATCCC
TCCTACGAGGGTGACGGCGCGGTTTGCAACAGGCGCATCAATAACAGGGATGGAAGGTGTAGTGGGATTTCACTACACGCTAGACGAGTTACAGTATGGT
GATGATTTCATCTTACTAAATTTAGATGAAATTTTTTATGTCATCCCAGGGTTACCCTGGATCAGAGGGTACGAGCGAAGGCTCAGATGGCAACATCTAA
CCGTGAATATTCCTGACACATGATCATCAGATGGACATCTGATGAACGTCTTGGAGATTCCACAAGCGTGTGGATGTAGTGCAAGTGAGCTCACTTGTGG
TACATTCGTTTGTAGGATTGCACAAAATCACATTGTGACAACCAATCACAGTGTGGAGGAAGATGACGTAGGCTGTGCGGGTGCACAGGCAGCGCCGAAG
ATCCACCACTCCATTAAGTCGAGTAGACCGGGATATGGATGTATGACTAGCGGGCGACATACACGGAAGAATAAACCGATTGCCTACACAGGGTAACACG
TTGATCCTAGGTCGACTGAAGAGTCGGCCGTAGAGGACCTGGCTGTGGTAGCGCAATTAGAGCTAGAAAACGTCGAGGGAATATGTCCCCACGTACTTGA
GGAAGAAACTTTGCAAGCTGTTGTTGCTAATGTTATAAGACCACATCAACCTGAGAGAATAAGTCCCCAGAAACCTGCGGCAATATGTTCTTAGAAAGAA
ACCAAGACATTGAATGTTATGTTCAATGACGGGTCAAGAGTAGGTGCTTATACACTTGATCTGATCGCGTCTCCAAAGGTAACTTCGGAGATCACTCGGT
TGCCAATGGTAGAACCGACGAGGTTATTGCTAGATCTGCGTAGTGACAAAGTGAATCAGATCTGCGTACTCCTTGCATAAGACGAGTACGTAACCGACAT
TCGGTCGCCGTAGTATGTTGCCTAAAACCATATTTTCAGCAGCTCATCGATGGACGAAAGTGTCCTCGATGAGAAAACTTCGATTGAACGATATACGTCT
CAATCTTGAAGGTCGCTTCAGGAAAGTTCGTTGTATAAGGATTTGATCGAATTCGAGGATGTGTTTCCTAACTCCGTTCCATGCGAGTTGCCGCATGATA
AAAGGAATCGACATGGAATCGAGGTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGCGGCCACTACCTCGTGAACAAGTACTTGTGGTCGACAAATT
CTTTGTCGATCGCTTAGATGCGAGTCATGTAAGGGAGTCAACTTCCCCGCACAACTCTCCGACCTTCTGTGTGTGCAAGGCCACATGTGGATGGCAGATA
GTGCATGCATTCAACAAGTTAAATGCTACAATGAAACCGGCTTTGACGCCGATACCGAGGATGGACGTTATAATAGATAGAATGGAGAATAATACCATCT
TTTCGTTCATGGGTGTGATAGATGACTTCTATCAGATCCTTAAGCGCGAACGGGACATCCCGTACACAATAGTGATCACCCCCAGTGTAATACTCTGGGA
GTGGCAGGTAATGCCAAAAGAGCTAAGTAATACTCCTGTCACATTCAACAGATGTGTTACACATCTTTTAAAACCGGTGCGAGATATTTCACCGTGTTAC
TGTGACGCTATATTCGTCCATAGCCGGGATATGGACGGAAAGACGGACGTGGTAGTTCATAAGACGCAATTTCAACAGATTTTTACACTTATGCGCAAGC
AAAAGCTGTAAGCCAACCTTAAGAAGTTTATATTCGCTACTAGCGCAATACGACTTCTTGGATTCATTGTGGGTAAACATGGCGTACTCTCTAATCCGTA
AGCGCTCAAGTCGATTACCGACTCATCTGTGCCAGTAGATGTCACGGGAATTAGAAAGTTCTGTAGGCAAGCAGCGTACTCGCACAAGTATTAGCGCAAC
TACGGCGAGATGACCGTTAATCTCTCTAGTCTCTTTAAAAGAACCAAAACTGGTCACCAAAGGCTCGTTGTCAGCGTTACTTTGAAGGTATTAAGCAGAG
CTTGATGCAATAGCCTATCTTAGCGATTGCAGATCAGGACATAACATTACATGTGGTCTTCGACGCCAGCAATTTCTCACTCGAATGTGCGAAATGCAGT
TCAATACTGACGGCGCAAAGCGTCGTCAGATATCTGTCGCATCAGCTGCAAGCAGCTGAGATCAATTACCCAGTACATGAAAAGAAATTCTTGCCATGAA
ATACGCACTGGCTAACTACGTCTATCTCCTGGGAGATAGACAGTCGTCGTGTATAAGGACCATGCGTCATTACGCACGTCAGTAAACAGTCTCCATCGCT
CGCAAATAATGACGAGATGGCTGTCCTTCTTTGCGTGGTAAAAATTATCTGTGGAGTATAATCCAAGACTACTTAATGTCCGCGCTGATGCATAATCGCT
CCAACCCGACTTGGATTCGGCTGCACATTCCGACAGTGAGGGCGAGGTCACTGTTGCAACACTAGCTGTAAGTGTTCCGTATTAAAAGTTGCTTGAAGAC
GTTAAGAAGGCCTACTTAGAAGATATGGATCCTCTACGTCGGATAGATATTTGGTGAATTTATATCGCAAATCTCTCAGAGATTTACCGACCTTGTATCG
ATCGTCTTTGGATCGATACACCACACGCAACAGGCTGCTGTATTTTAAAGCCTTTGCCTGCGACACGCCTCGTGTCGTCGTTCTCAGTCATAATAATTTG
CGATTGCACATCCTATTTTAGTGTCACGATGCACCAACATGTGAACATAGCGATAGGGAAAAGACGTACCTCACGGTGTATCGTAACTTTTACTAGCCCC
GACAGTGTCAGTTTGTGCGCAAGCATATTCGCGCTTGCGAGGCGTATCAACGGATGAAGCCTAGTCTTTCATCCCGAGCACCACTACAGCCTCTACCAGT
TCCGGCAGAATGCTAATAGTCCGTGTCCATTAAGTACAACTTCGGGTTCTCCGAAGACGATCACAGAATCATGTTATTGTCGTGTTCGGTGATCGATTCA
GCAAGATTATACATCTTGCTACAGTTAAAGAGTAGATCACAGCACAGGGATGTGCCCGTGTCTTCATTGAAACGATCTTTCGACTCCAAGTCTACCCCAT
GAACTTGTCTCTGATTAAGATCTGTAGGTTGATGGCGGGGTTTTGCCAATACATGTTCCGATCACTCGGGACACGTCTGACTATGTCAACATATACCCAT
TTAGAGACAGAGTGTCAGGCGTAACGCATCAACCACGGCCTCGAAAAGACTTTGAGAATACGTCCAATCTCTTACGGATCATGGCAAATTATTGCCAATG
TTTTATTTTGTCATCAACAACTCTGTGCATGCGTCAACAACGCATACACCGTTCTTAGTGAATGGCTTTCGCCATCCACGCCTACCCACCCACTAAGAAA
TTGACGCTGGTTCAAAGGGGGGAGGAATTCGCTCGAGCAAAGCCGTTATGGCTCTTGCTCATCACGCGTCGAGGTACTCGACGACGCAAACGTTACCGAT
GTCGATCTAATTGACATTGAAGAAGTTAACATCTTCAATAGTGACAACACTATTGCTGACGATAACGATGCTGGTATATTCAGCATCGCCAATGACTACA
CCATCGAGGATGATAACACCCTCGCTGAAGAAGAGAATGATCTCTTAGCGGTTTGCACAAGGCACACTAGTGCAAACCGCTAAGAGGACCGGTAGAAACG
AAACGCTGATAAATTTAAAAGGGTGAACGTTCTTTTATTTAATGTCGGAAACTTAGTCCTGATGTCCACGGGCAATCTACCTAAACATGTATTAAAAATG
TGGGTAATAGTTAACCACTACCCAAGTAATCCGCCAGTTTTGTGTACTCTATCACAAAGGCAATGCGTACAGGATCAAGTTGCCTGTTAGGATGCGTACG
CATCCTACGTCTTACGTTGGTCTCCTCCGGACGAAGTATCAGCACGAGGCTTCTTCCTC