Description :
From Genome Similarity Track
Location :
Scaffold_208:18471- 21053
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.16Dynein light chain type 1
Pytul_var.sporangiiferummaker-pug3_contig_208-fgenesh-gene-0.10Conserved gene of unknown function

Sequence
2582 bases(100 bases per row)
ACGTGAGTTTTGTTACTTGCTACTGTCTCCTTGGATTGCACTGCTTGCTTGGGGACACTGATCACCATGTTGGCGTGAATATGTCTCTTGCGTGAGCAGA
ATGCTATATTTCTTTCTAGGGCAAATCGGCTTCTTAGTCTATAGACATGGGTGAGGAGAGAGCGAAAGCAGGCGTTGCGTTTAAATAAGAGTTCATATTT
GATTGCTTTACCTCACGTTTGCGCGTCTTCTCTACACATGTTCATCGTTGTGCTCTTCTTGCATTGTCTCTTTACCGCACGTGCTGCTTGCTTCCTCCAG
CGTAGCTCTTCAGCAGACATTCACACCGTCTTTACCGCATATCCTCCAAGCAGAGCCGAATGCACATAAGCATCTCTCTATTGTCACTTGTTTCCGTGAC
CAACTCCGTCCACTCGACCACCGTTCTGCTCCAAAAATCAACATTTCTCTGCACGTTTGCTCATCGGACATATCCGTTCGGATTGGGCTGGTTCTGATGC
GGATACTGAGAAGTAGGCGCGGCCGTGATATGATGAAATGCGCGCTTGAGTTCCTCTCGGACCATTGCGGTGTACTGCACGATCCGCACAATTTCTTTCT
CTCGGTCTTCCTTCCATCGTCGAATGGACTGCATCGTCACCTGCAACGCTTGATTGATCTGCAGCACACTTTGATGGAACGCGTTCGGACTCATCAGACT
CGCAGTCTCCAGCGTGATGGCCATCTGCTGTTGCAGCGTCGCTGCGTTCGTATTGGTTATGTTGATCTGCTCCGAGAGCTCCATACACTTTCGGTGGCTC
GCAGTCGTGACCTGCGGGATATCGGACAGCGAGTCCATGCGCAGCCGCTTGACTTCTCGCATGATCGAGGACGACTGCAATATCAGCGCGACCAACGCGG
CCGTTCGATTGGTCTGAGCTACTTGGAGCATTTTCTGTTGCTGCTTGAGCGTCGTCATCGACTGCTGTGCAGCCTGTAGATTCTGCGTAGAAAGCTGCAC
GATGTGCGCATTCAACGTCGTCACGCTATGCTCCAGCTTGATTGTGTACACGTTGACCTCTTGGTACCGATCGTAGAAAACTCCTTCAAGCGGATTTGCA
CTCCAGTCTGTCGGAGTCGGGGTCGCAGACGTGAGTGTGGTCGAGTAGCCAGCTGTCGGTGCTGGCACATCTGGCACCGGGATCTGTGGCACCTGGGGGC
TACTGTTCCCGGCTGCAAAGCCATTGGAACCGTTTCCAATCGGTACATTCGGCGCTCCTGCATACGCACTGTTTGCCTGCATCCCCACTGGTGTCGGCGG
CCGCGTTGGAGGGGCGTATGGANNNNNNNNNNNNNNNNNNNNNTCTGTGTCGGCTGTTGCACTATCACTGGACTGATCCCATTGGACTCATTGACGCTGC
CTGCCGAAGTATTGATCGTGTCGTACGCATTCGAGCTCACCACTTGCTGGATCCCAAACTGCTGCATACTGTTAGAGAGAGCGGTTTGAGAGCTCACGTT
CGGGGCAGGGGTATTGATCGGTTCAATGGCCGTCGTCAATGGCTGCTGGAATTGATTTTGCTGCGGGACCACGTTTGGATTCGCTGCCACCAAAGAGGAC
CGCTCCGTAGTCGGATGTGCACCTGTCGTTGCCTGCGGATACGTGCTTCGCTGTCCTGGCCAGCCACCCTGATTCGACCTTGCGCCAATTTGAGACTGCT
CCATCGCACTCAACTGCGCTCGAAGGATCCGATCACGATCAATGAACCCATTTCTGCTCCCTACATCAGCTGCCAGTCCTGTCTGTCTGTTGTGCCTATT
GCTTCCATCGTCTTCCGAGTCGGAATCCAGCAAGATGACCTCGACATTCGACATCTCTCGTTTTCTTTTCTCGCCAACGCCGCTCTGGTCTCCAGATTCG
TCTATCGTGGCCTGCGCACCTCCGCTTGCATCATTTGCACTCGAATCCAAGGTTTTCGCGCTCGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCATTTCCGTGATAGTTGTCTGGAAGTTTTTCGACCAATTTGCCTTTTTCAGGAGTGATCCTCGCGCTCCTGAGCCGCAGAGAAACAGCAGCATGTTGC
GAATTATTTACAAAATGCCGACAAATTAAGCTGCACAACGCAGCAAAAAATGATAATAATAAAAAGAGACGCACCTTCCATAGCGAACTTTCTATGATGT
TGTACTTTCGGGATGCTGTGGATAGCGTCGAAGCACGCGGTACAGAAGCTCAGGTCGCATTCGGCACAATAGTACACGACGCGCTCCAGCTGGCACTGCG
GACAGCCTAGGGGATCACCGCATATTACCACACACATTATTCATGAGCTATTTACCGCCATACACCTCTACATAATAGTGAATAGCTCCATTTCTCACTT
GAGCACACTGTCTGGGGGTGCTGAAGCTGCTCTGGGGTCGTGTGGAACGTGTCGAAGCACTTGGAACAGACTGGCACACCGCGCAGGATGCAGTTCTTCT
CGAGGCATTTCTGGTCCGCGAGTCGTTGGAGCCCTCCGTCGCGTCTCCGTTGGCAGGGCGCGCATCGCGGAATCGCTAGCGC