Description :
From Genome Similarity Track
Location :
Scaffold_108:1847- 5926
Sequence
4079 bases(100 bases per row)
AGCACACAATGGGATCAGCAAAGAAGCCTATTGCAGTGTAAATCCACTTTACCTGGTAAGATGCGGCAAAATACCGGTCTAAATACGAGTGGAAAGCGTC
CCACGATGTGAAGTGGTGCTTGTCGGGCACAGCCAGCGTTACATTGATAGACTCAGAGTCGTCGGTGTTGGTCCAGTCGCTGGAGCGGCTGCTGTTGTCG
CCAGATTCCATCGGGAGCGATTCGTCGACCATTCCTCTTCGCTGGACTCGACCGAGACGTTGGATGCGTCATCATCGCTTCGTGACCTTGATCCACGACG
TTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGCGCCCTTTGCACTTAATTTAAGGCTATTTTGGTGAAGTTATCGCCGATTATCCAAAGATAATAAT
TTATTTCGGATTAGCTAGCCCCATCATTTTCTGCCGCTATAATAGAAGGAGGCAGGGCCGCCGAAAAATAAATGGCACTTACAGTAATGGTCATAAATAT
TATCACACTATTTATGAGTCGTGAAAAGTAGTAGATCATAATTTATGCCACCAAGGTACTATTTTCATGCATAATTTATGAGAAGGTACACTTCTTACTT
AGGTTAGTATGCGGAAAAGCGATTCTTCAGTATTGCTCGCACAACTCTTGGGCACGAGCGTAATGGCCTACAGCCTATTACGCTTGAAATGATCCTATTT
CTACGAGAAAACTCGCGCTTTTGGGATGTTTCTACTGTAGATCAACTCCTGTAGCCCATAACGCGCTAATCAATACAAGTACGAGTCGATCACCATAATT
GATTTATCACTAGCAGATATGACATTATTTATGAAGTCGATTGCTAGACAACGTCACATTATTTATGATCACACTGAGCCTTCCATTCATATAAATATCA
TAATCGGCGGCCCTGGAAGGAGGAGAGTCGCACTGGTCGTCTTCGTATGGATCTCAGCAGCCCCGGAAAATATGAGCACATTCATCAGCAGTCTTCCTCG
AATGTCCAATGTACTCGCTTAGCAATTGCTGTTGCTGTATATCAGATAAATATATAAGAAGCCAAAGCAGCGCCCATGTCTCTGTAGTAGACTTCTCAGT
CAGGGATGCCAATTATTGCATTTTTATCTATTGCTAATCAAAGCAGAAAATAAATAATTGGGTTAGAGAGCTGACTAGACCAAAATAGATTATTGAACTT
CCTCAGCTCAAAAAATAGATTATTGGTGCAGCAAAATTGGTACACAGCGAGGGCACCAGTATCAAAGAATGTATGGCCAATTAAACACCGCCCAACAGAT
TATTGGTGCTACAACGGGAGCGAAAATAAATAATTGATCTTCCTCTCCAGAAAGTCTCCAATAGATAATTGGTGCTTTCTTATTGCAATAATTGCAGCAC
CAATTTATTTTTCGGCATCCCTGTTCTCAGTATCTTTTCGGGTGTCTATCCTGTGCGAGCGTTTTTGCTTTTCAGTTGCCAAATTCTCCGCCCTCATTGA
ATTTGGCGTTTTTTTCCCATGTAAAAATTGCTTTTCAGCTGCTTTAACTTCAACACCCAAAATTGAGCGAACTCCAGTTCTCTGCCCTCATTTTACACCA
CGGACGGCATGGGAAAAACCCTTCGCACGATCTAAGCAGCCTCCAGCCTGGAATGACTTTATCGATCTCTCTTGTATGGCAGCTCAAGTGAGCATGGCCA
CACTGGCGAGAGCAGCTCTCTTGTCCATCGACGCAGTGTTTCTTGGCCATCTGGGCGTTAAGGAACTTGCAGCAGCCTCATTAGCTCAGCTATGGACGAG
TCCTGCTCTATATTGTGTGTGGGCCTCCGCCTCGGCACTCAACACGGTACGTTTACATGTTTCACTTGAATCCTCTCAGCAAGAATAAATGTCGTGTGAG
CAGCTGTGCGGTCAATCGATCGTCTCGGGCACAGCGCGGTTGAGGAGTTTGCAGAGCAGCACACCGTCGCACACAGCTCGAAACAGCCCCGCGTCCGTGC
TGATAGGCATCAGCGACGCCACATCGCTGTCTGCTTGCAGCGTGTTGTTGATATGCTCAGTGAAGGCAGCCGTCTCTTCCTCCGAGTACGAGTGGAGACC
GCCTGCAGTGCCCTTGACCTCGTGGATTGTTGAGTTGTATTGCGCTGCTGCACTGGCACGACGCTGAAGCACACTCAACGAGTGTGCGTCGACGCCACCC
ACGTACTCCGCTACAGGTGACGGTGGGGCGGCCGTCGGCTTCCCGGGAGAACGAGGAGGCGTACGAACTACTGGAGGAGGCGGTGGCGTATTGGCTGCAG
GCGGCCACTGAGCGCGTTTGGGAACTTCTGAAGGAGAAGAACAGGGATGCCGAAAAAAAAATTGGTGCTGAAACTATTGCAACTAGCCGAGTGCCGCCGC
TACGCGGCGGGTAAGAATGAATGTCGCTCCTTGTGTTTTGCCACCGTTCCGCTCGCCACGGGCTCGCTTCACTGCTCGCACGGTAGGTTGGAAGATTATG
GCTCAGGCGGGCCCAAAGGCCCGCAGGGTTGCAGAAGGTGCCGATTTGGGCCGCCTCGCTGCGCTCGGCAGCTTTTAGGCCAATCGTGGCCACCTTCGCT
GCGCTCGGCAGCCAGTAGGAATATTTAAATTATTTTATCCAATGATTTGTCCGGAAAAGCGTGACAGACACGACAATTTAGTGTGACGGACAGACAGGTT
GCTGCAGTAGATGTTTAAGACTAGCGCTCTGAACGCCCGCTCCGCGGACGCTAGGGCATGGTCGGTTGGTATAGAGGGGGCCGACCACCTCCGCTGCGCT
TAGAGTTTCTACTCAAAGCAAAGCAGCATATAGTCAATGTATACTGTGATCTACGTATATTACGTTCCAAAACAGCACCGCACACAGTATCCTTATTGCT
CACATGTTATGGTAGACATGACCAGGGTTTAACGTGATCTGCAAGATGAGCACCATCTTACCCGGGAAGGTTTTGTCTATAATCTCGTTTGAACGCATTG
CTCCCAAAATGACACGAATCGGAGGCGCGTGTAGTTGTCAGGTTTATATATGCTGTTCAGAAGACGTGTCAGTATCAATGATGACCCAAATTGACATAGT
TCGGTGAGGAATCCCAGTTTAGCTGGAATAAATACGCGTACACAAACATATTACAATCCGTCACGTCATCGCTGTGAAGCAGTCGACACCGTATCATTGA
TTGCAACGGTCTATTAGAGCAAGGTTTGGTCAGCTCCTCGCGCGAAGTATATTTTGGGACAGGAAGGTTTTGCCGATGGTCGCCACAAACACCAATATTA
TGTCTTTAAAATGTTCCGCTGAGCTCTTAACGATATTACGGAAGAGTCTTTCCACTATCTTTCCCATGCATTGATCTTACTTGCCTAGCTGACGCACTTA
CTAACTTCTTTGCATAGCTACTGACTGACCAAGAGGCGTAGATCCTTTCCGAGTAGCATGCTCTGATATGTATGACGAA