Description :
From Genome Similarity Track
Location :
contig_5:184656- 201728
Transcript NameFunction/comments
g1526.t1hypothetical protein
g1527.t1RAW34156.1 hypothetical protein PC110_g9523 [Phytophthora cactorum
g1528.t1hypothetical protein
g1529.t1hypothetical protein
g1530.t1hypothetical protein
g1531.t1hypothetical protein

Sequence
17072 bases(100 bases per row)
GTTTCGGTCTGTGCCACTCAAAGCCGCTCCAACGTGCGGTTGTCGACTTTCGTCTCCTCTTGCAGTGATTTGCGGTCGAAGACCTCATCCTCCTCATCGC
TGCTGCTTTGGTCATCATCATCATCGTCTGCGTCAAGCCGCTGGTGTTTCGCGGAGCCCTTCTTGTCATTGCGAACCATCCCAAACTCTTCCTCGTCGTC
GTCATCCTCATCCTCCTCGCTGCCTTTCACGCGGCTCCAGAGCTGGTCCTTGCCTGTCTTTTGTCTCCGCCGGCTGACCGAGATCAGCATCATCAGTAGA
AAACCAACCACTAGAACTGCACCCACGATCGTGAGCACCATTGGGTGGGCGCCACCTGACGATTTTTCCTTCGCTTTCGGGTCTGCGGCAACACCTGACG
ACGACGACTGAGTCTTTGTCGTTCCTTCTTCCGACAATGGCTGAATATTCAAATCCGCCGTACTAGAAGCAAGGTCCAGAGTGGAGATATTTGCTACCGT
CGCTTCTGGTGTCGATGCAGCCGTAACAGTTGGTTCCGAGGTAGCTGCAGCGGAAGTGGGCTTCGGGGATGATTCTACCGTTGCTTCCGTAGCTGAAGGG
ACTGTTGCAGCATTGGTAACAATAGGGACAACATTGTTCGTTTCACCATCAGTGCTACTCGTTGAATCGTTGCTGATGGACGGGGAAGCTGTTGTCGAGG
AATTGCTTTGGTAGGCACAGTCTGCGTCCACAAAACCCACTCGCTGGTTGCCAAGGTCAAAGATCACATCACGGTTCATCATGAGATTGGCGCCAATGAC
ACCACCAGAGTTCTCTGAGAGGTAAATACTTCCACAGAAGGCACCGTTTGCGTTGAGGAGGTACTGCTCAGGCGGCACATCCAGGACAACTTCAGCATTC
TCATCTCCATACGCTTCCATCACAAGCTGGATCGTGGGTAGTGACGCCATATCCTCGTTCGTGAAACCATGGCACGATGTGCCCACCTGGTAATCACGGC
CCGCGACTTCCTTAAACATCTGCAGAAACTCGGTCTTCAAAGCGCGGGGGAGGTACGAATCAGTAGTTCCGCTGTCCACAATATAGTGGCCTCGCGTGTA
TGCCTCTTCCTTGGCGTTAATAGACTTGCCCCCGATGCGAATGTCCTTCATGTGAACATTGTAGAAATGGCTATAACACATGGAACGAGTAAACCATTAA
TAAAAAACTCCACAGCGGAGCAAGCAAGCCAATTGTACCTGGCAGATCGGTCAGAGATTACTTTCGCGTAGGAAATTTCACCTCGGTGTGCATTTGTGTT
CGCTTGTCCAACCGACATGGTTCCGCCTTGATCAGTGAAGCAGAGCGAAAACAAGTTGCTGGGAATTTTGTTCTCGCGATGGAGCTTCGCAACAATATGG
TTATCCGCGTTGGACAATCCCATGATGCCATCCGCCACCTGAGTGACGAACAACCCCGTTTCCGAGCTCTGACATCCGAACTGGAAATGCGTGCCGTAGC
GGTTGCGCATCTCCTCATCCTGGAAGCTCGTTTCTCCTCCCAAGTACACGACATCCTCGACCACAGAGGCCTTCCAGCTGCTTCCCTCCATGTACGACTG
AGAGATGCCGCACGTGTCCGATGTCTGCTTGCACTCCTTACACTGAAGAACGACTGCTGAGAGCACGTCACATGCACCAACGTGGACGAATTGTCTGCCA
TGAAAGGTTGGTCCGTGTGGCTGCCACATCCGTCGCACCCCGAGCACGGGAAGGCCATGAGTCCACTGCCTGTGTCCGCGATCACCGACGCTCTCTGAGG
CGGGGTACCAGCATATACCCATGTGTAGTGCGTTCTGGATCAAGCACACGGCTTCATTAGACCCCCCATCCATCACCCAACACTGTAGCAACGCTGCACA
AGGCAGGATCAACTTACCCAAGTCCCAAATGCAGCGGCACGAGCTCCGGCGCGTCTTCTTCGATGTTCAGACGCCTCGCGTATCTCTCGGGGTGAATCTC
GTGCTGCGGCAGGCGGTGCAGCTCCATGGTCATGCCAGCGGATTGTGCAGCCTCCGCCAGAGTAGTTATCGTCGAAATGGCAGCCAGCAACACCGGAATC
CTGCGTACACGTGCACCATCTTGAGTCTCTGAGTGTTGAGCCCCCTGTGTCAATTCTGCGTCGTAGGCGGTGGTTGGACGCTGGGGATCTCCCTATCGAA
CTGGGCTACGTGATGGATGGGTGCTGGGCAGTGGTACCGGTACTAACCACACAGTGTGAGGAAGAGGGTCGCCGATGGGAGAGCGAGCGCACGTGGCAGT
TTCCTCCTCAACGTCTTGTGCTCCCTATTTTCGCTGAAACGACGACCCAATCGTAAATGTGAAATGAGCCCAAATCGTACTTTGTGTTTGATTTAGAATT
AGTTTGGGTCCCGCAGCACGCACGAAAGAGCCGGAAAAAGTATCTTTCAAGTGCTGACTCTCTTAGTCCGTGAGCGCCATTTCGTGGCGCAGTAGCGTCG
ACCACGCGCTGGTGTCACGGCGTTGGCGTTGGCCAGGAGAGAGCAGCTCATTGCCGTCGTCGAACGTTTTCTTGGCGTTTGGCTGCACCGAGAACGCCCG
CAACGTGGTTGTGGAGTCAGCCATTCGACTTGCCAGGCCCACGAGGGGGATGCCAAAGCGAGAGTGAGGTGACCAAGCACCGCGAGGTGATGCAGCAGTG
ATTGGGTCCTTCTTGGCGTTGTTCTGAACAAGAATATCATGACGGATTTCGTCCAGCAGCTGCTGGCATTTCGGAGACACGACGCGCCGGGACTCCATGA
AGACACCCGTGTTGGGCTCAGTTGGCAGCGAGGCTTTCATACTGAGCAAACGCTTGCGGAGGTCATTCTCACCCGGTCGACGATGCTGTGCCAGTAGGGC
GGCAGCTTTTAATTCCACTTGCGAACCGTCGGGATGGCCCCCCTGATTGCTGCTGCTGAAATGTCGCCTTCACCCGTAGCAAGGTCGGCATCCCCCGACA
CAAATGAAAGGCGGTGGTGTGGAGTGGCTAGCTGCTCTGCAGACATGACGCGAAGTTCACCTGCAAGTTGTAAATCTGCTTTGACTTGCTCAGCACTATT
GTTCGACCCGTGCGCAAACGGAGGGAAGTCACGCTGTTCCGCACGGAGAAGTTTGTGTTGGCTCCAGGCAGAGAGGAACTCCACGGCTGGAAGCAGCGTT
CGGTGATCCTCCAGGCTTTCATCCACCCAGTCGATTTGCTGTAATTGTCGTTCAAACTCGAGCGCTTCGCCAGACAACACGCGCGTTTTAACTGATACCG
CTTCATCCAGGTTGCGGAGAGCACGTGCACTGCTCCTTGATTGCGGCTGCGACGTGCGTCTTGTTGTCTTGCACGGCCCGTTGAACCCTGGTCAGAAACT
GTAGCTTGTTCTCGATCACAGTCTTGCGGGATGTGATCAGTGGATCAGGACGCAATGACTCCCGTAGACAGCTCTCGTACGCATCTGCAACAGTCAGCAG
GCGATGCGAACCTTTCTCTCCAATCGAGTGGTCTCCAATCATTTTGCAGCTCACGCACACAGGAACCTGGCACACGGGACAATAAAACTCCACTTTCTTG
CCACGGTGAGCGGCACGTTGGTGTCTGTGTATCATCAGCCAGGAGACCTTCTTCCATTTGCTTTACAACGATCTCGTTGATGTGAGCCTCCGTCGGCTCC
GCGCTGCTTGGCGGGTTCACGAGACTTTCCACGCCTACTTCCGCAATGGCAGTAGCAAGAGATGGCGTTGAGCTTCGACGTCTGCCGCGTCTAGCACCTC
CGCTTGCTAAAGCTTTTGATTTACTGCGCAGAGGTGTACGCTTGTGTCGACGTACCAACTTGTTTGCCGAGTGGACTTCTTGGTCGCAATGAGCACAGAT
CTGTGCCTCGCAATTACGGCAGACAACAACAGCGGGGTGCTGCTCACATAATGCACATGATCCCACGGCTGGACCATGTGCATCGGCTGCGGAGAAGGTG
AATCGCACGAGGTACTGGGGCAAGACCTGAAGTGTGTTGTTCAAGATGTACTCGTGGTAGTAACCGCGATCCAGCAGTGCAGACTGGAGATCACGCTCCT
GCTCCTGCTCATTCGAGCTGGAGCCTTCATCACGGTGCAAATAGTAGCTGTGGTAACCAGGTGGAAGGCGTGCTTTGGCCTCTTCCTCTTCATGAATAAC
AAGAGATCGTCCAACCGCAATCTTGCAGAGCACGAGCTGCCGCGTACTTGATGGCTTCTTTGCCTCTGCTGGAGGCTCCGGAGGAGGTGGAGCACTGAGC
TGAAGGTTTCCTGTGGTGAACTTCATCCCCGATTGGTTGGCATCGAGCGATGTGAAGCCGTAGCTGTGGACGTCACCCATGTCAGCGCCAAGGTCGTTTA
CGGCGACCCACGACTCGAGCTCTAGCAATCCTGCCGTGTGCTGCTCATACTGTGCCACCAGAGACGGATTGCGCATATCCCAGATAACAACGCCCTCGTG
CACACGATACCCCGGCAACGAGCACTGCAGCAAGTACCTCACGCGTGCAAATTCCTTGGAAGACTGGCTCATCGGCGTCACACTTGCCACTGCTCCTGCG
GCAGGAATGGTTGTCTGCCCAGCTTCGTCTTCTTCGTCATCCACTAAAACTTCAGGATGTGACCCCGTTTCGACGCCCCATTCAGAGTATTCGCCTGGCG
GTGCTGCTGACGAGGTGACTTGCGAGCTAGCGTCGTCGGAGCCTTCATCTTTTTGAGCCCCCTCCACTGGACGCTCGGGTGATGCAGGCCGAGCAGCCTC
GCCTGGTCCATTCGGGGAATGCGACGACAAGAACAGCCGCAGTCGCGCAAGCGAGGCACTTGCCTTCGCCTCGTCGGCCTCGTTCACTACCATTGGTACC
AGAGTTCAGCCAAGGAGATGATCGTCGGTGCGTTTTAGATGCCGTCGTTTCGGATGTCCTTTCGTGAATTGCGTGAGTACAATATTGGATTGAGCTCACG
AGCTGGGAGCTGGGGTGGTGTATCTTCCTTCACTTGCAATTTTGCCGTACGGCCCAATCGCAGTCACCCCGATAGAGCAGTGGACCATAGTCCATGAAGC
GCCACGCCTTCGCAGTGTGCTACTAGTAACGTAGTCTTAAACCGACTGCACTACGCTCATATTTGCTTTAAAGCGGACACAGCGGCAACATCGCTAAGAG
CAATGCAATGCAAAGCGACAGGCACCATAAGCTCCAGCTGCAAGCAATAGGTCCTCGCCGCAGCAATCCGTTGACAAAACGGTCGCGGTCGTTCGAGATT
GCTGCAGCAGCCCAAGGACAACCAAAAACTCACGTCGCAGCATCAATTCCGTGCTGCAAAGGACCATATTGCAGATCTGGTCGCTCCCAGTCATCGGCAC
CAACTCAAATCGAAAGCGCGCCAATGGGACACTCAGTTCCCGCCACCTCCAGCCGTCCAACCAATTCAAATGGCCGTTCTCTCTCGCGACCAAGCGGGTT
TCCTTTACGGCCCGTTTTCAATACAAACCCAAGTCAAATACGGAAATGGGCCGTAATTTTGGAACCCGTAGCTCTTCGAGTCAAAAAGGCGTGCGCAGCC
ATTCGGCCATTTGCTTTGTCTACCCATACATCCCACCATGAAGTACCTGGCAGTGACCGGCGGCACCGTGAGCGGCCTGGGCAAGGGCATCACCATCAGC
AGCATCGGCGTCGTGCTCAAGTCGCTGGGGCTGCGCGTCACGTCCATCAAGATCGACCCGTACCTCAACTGCGATGCCGGCACCATGTCCCCGTTCGAGC
ACGGCGAGGTGTTTGTGCTCAACGACGGCGGCGAGGGCGACTTGGACCTGGGCAACTACGAGCGCTTCCTGGGCATCACGCTCACGCGCGACCACAACAT
CACCACGGGCAAAGTCTACACGCATGTGCTCGAGAAGGAGCGACGCGGTGACTATCTGGGTAAAACGGTGCAGGTGGTCCCCCACGTCACGGACACCATC
CAGGACTGGATCGAGCGCGTGGCCCAGATCGGCGTGGACGGCAAGCACGCCGGCGAGGCTGCCGCTGTGGACGACGAGGCCGCCGATGTGTGCCTCATTG
AGGTCGGTGGCACGGTCGGCGACATTGAGAGCATGGTGTTCCTCGAGGCTCTGCGTCAGTTCCAGTTCCGCGTGGGCCCCGAGAACTTTTGCCTCGTGCA
CGTGTCCTTGTCCCCGTGCTCGGCTCCGTGGGTGAGCAGAAGACCAAGCCCACACAGCACGCCATTAAGGAGCTGCGCAGCGCCGGACTGTCCCCCGACG
TCATCATCTGCCGCAGCAGCACCGAATTGGAACCGGGCACCAAAGCCAAAATCGGCATGTTCTGCCAGGTGCCGGCCAACCACGTGCTGTCGGTGCACGA
CGTGAGCAACATTTACCACGTGCCTCTGCTGCTGTCCAAGCAGGGAGCTGCTAGCATTCTCATGTCCAAACTGCAGCTGATGGACCGCTTCTGCGAGCCG
GACCTTGAGGCCTGGTCAGCCATGGCCCACCGCGTCGATTCGTTCGAGCAGGTGTGCAAGATCGCGCTCGTGGGCAAGTACACGGGTCTGCAGGACTCGT
ACCTGAGTGTCATCAAGGCGCTCAAGCACGCCACCATGAAGTGCAACCGTGACCTAGAGATCGAGTGGATCGAGGCCAGCGACCTGGAGGTGGACATGCG
TGAGAACGACCCCAAGGCCTACGAGGAGGCCTGGCGCAAGCTGCGCAGCGTGGACGGTATTGTCGTGCCTGGCGGTTTCGGTGACCGTGGTGTGGACGGC
AAAGTGCTCACGGCCAAGTACGCTCGCGAGAACCGGATTCCGTACCTGGGTGTCTGCCTGGGCATGCAGGTTGTTGTGATCGAGTTTGCGCGCAACGTGA
TCGGCTGGAAGGAGGCTAACAGCGAGGAGTTTGACGCCGATGCTGAACACAAGGTGGTTATTTTCATGCCTGAGATCAACCCGGAGGTCATGGGTGGCAC
TATGCGCTGCGGTGAACGCCGCACGATTGTGCACGAAAAGGAGGACCCGGCGAAGCGCTCGCTGGTGTCTTACCTGTACGGTAAGGACAAGCCGATCCTG
GAGCGTCACCGTCATCGTTACGAGGTGAACCCGGAGCTTGTGCCCGCCATTCGTGAGGCTGGTCTCAACTTCGTCGGCACGGACGAGAAGGGCGAGCGCA
TGCAGGTCGTGGAGCTCGACCGCGACGTGCACCCGTTCTACTTCGCCACGCAATACCATCCGGAGTTCAAGTCGCACCCGAGCGACCCGTCGCCGCCGTT
CCACGGCCTCATTCTCGCTGCCACCGGTCAGCTCGCCCAGTTCATGAAGGACGTGGAGGCCAAGGAGCAGGAGCTGTAAGTGCTCGGGCGATTCGAGCTA
GAGGCGGTGGAAATTGCTGCGACGCAGAGCAGGTGGACAAGTGGCGCGGCAGGACGCAACGACGATGCCTCTCTCGCAGCAGGTTTGCGTGTGAATAGGC
TAAAATATTGATTTGGACCCCTCCACTCCGATGTCTTTGCCTTTGTTTTTCTTCGTCGAAGGAAAACGGGGCGAAGCTCTCTCGGTGGGGTTCCGTGACC
AGCCCACGGCCAGGTAGAACTAGCGTTAGACCAATAGACATATATTTATTCCAACTCAACCGTCTGATTGTCCGCATGAACGCCAGCGAGCCCAGCACTA
ATGCTTCGGCCACATCGTGCTGACGCACTTGGTCCAAATGGCTACATCTGAATTTGCTCATTTTCGGCGAATCAGAATGCTTCGAGTGGCACTCAACGTG
GCATTTCCGAAAATGTCTGAAGAGCTGCAGGAGGCGGTGGATGGCTTCTTCCTGGCGGCGGAATACGGCCGCTCCGACGTCATCAAGGCACTGGCGGACC
ACGGTCGCGGACGCCTGTCGCTTGGAGACGTGGTGGATCCCGTGACGGGGCGCTCGCCGCTGCACGTGGCCGTAGCGAGCAGCAAGAAGGACGCGCTGCG
GGTTCTGCTGGCCGCTGGCTTCCCCCCGCACCATCAGAGCAAGCAACAGGAAGGAAAATACACGTTAGAGGGCGAAAATCGGTCGGCGTACGCGCTGGCG
CAGCAACTGAAGTCGCATGATTTGCTGCTGGTGTTCCACCAGTTCCTGATCCAGCAGGTCGCGGCCAACGACGTGCAGAGCGTCACACAGTTACTGACGG
CTGGCGTGGATGTCGGCGTGACGGATACAGCCACGGGAGGATCGCTGCTGCATTGGGCGGCGTCGTGCCAAGCAGTGGAGGTGATGAGGGACCTGCTGGA
GAGAGAAGACGTTCAGAAGCAGAAGCTCGTGGATGCTCGCAACGGGGAAGGAGCGACGCCACTGCACTTGGCGTGTCATGCGAACCAGGTGGAGTGCACC
AAGCTGCTGCTACTGCATCATGCTGATATAAGTGTACGGGGTGAGAAGGGGGTCAGTAAGGACAAGACGGCGTTGGAGCTGGCTACGATGGCGGAGGTGA
TAGAACTGTTCTCTCAAGGGCTAGGAGGGAAGAGTGAGGTCAGCGAGCCCAGGGAAACGCAGAGGGAGGCTTCAAAGGAAGGAGATAAGGATGCAAGCAG
CAATGATGATGTGTCGTGCAGATTGATGACGGTTGGTGGTGAGCGTTCTGGGGCCTGCCCACATGAAGCGCAGAACAGCAAACTGTTGCTTCAGCTCGAA
GAAAAGGATCTCCTGGTAAATCAGTTGAAGAAGACTATTGAAGTTCTCGTGCAAGAATCACAGGAAATTCAAATGCTCGGAGAAGAGCGTGTGATGCTGG
ACTATGTGCGCAAGCTGCGCGATGAGAAGGCTATTGCCCAGAGGCAGATTGAGGATGCGAACGACTACATCAAGGACCAACAGCAGCAACTCGAAAGCTT
GAAGGAGCAGATCCGACAAACATCCAGTGCCACCAAACAGGTAAGAAGATTGTTGCTGGCGTTAGTTGGCTGAAAGTGGTGTTCTTACGACTACTTCTTT
TATGTAGCAGCTTGAGACTGACCACGACATTCTCTCTCATACTAGTGATGGTACGGCTAGCAGCGTCGCTGGGGCCCCTCCGAATAGCTCCAACAGCAAC
ACGAATGCGCTGGATTTACACCAGCTCGATACACAGTTTGATGAAGAGGACGAGAACTCACAAGAACCCCGAGCTCAAGCACTGAAGTTAGATGCCTGGA
CATCGAAGGCTCAACGTGAGCAAGAAACATTCAATCGATACGTCGAAAAGCATGGTCCTGACATTTGGAGTACGGTGTGGAACGGTATCTTTACAGGCAA
TGAAGAGAAGGAGACGCACGATGAAGACGGCGAGGTCATCATGACGGTGTAGAATGAGAAACAAAGTGAATTGAATGATTTGCATCGATGGAAACCCAGC
AATGATTGTATCCCGCTACCGCATTGGCGAGGTAGCAGCTGCAGACGTATCCTGCTGTTGCTGCTTGTAGACGCTTACGAGAAGTTTCTCCCGCTTCTTG
GGTTGCTTGTATAGTGCACAATTGTTTGCGCACAAGTGTGGCGACGAGATTGAATTTTGTCCAGCCTTACCACACGAGCAAAGAGCTGGGGTCCCAAGTT
GCGCTTGAAGTGCACGAACATAGCGCTCGTGATCTTTTGTCGCTGCTGATCTCGTTGCACTCTTCGTTTTTTTCCTTGTGAAATTGCAGTGAATGACTAC
GAGCAATTCCAAGGTGCATGGCAGTAAATGTGTCTTACCTCCACGGAGTCGACGATGTGGTAGTCTGACGATGTGCTCGTGCCTCACATCCCGACGATAT
ATCAACACTGGCCACGACAACGTTAGCTCCAAACGGACCATACCAAAGAGAAGGACACTTCCCACGCACACTTCGACACCCGCGGAGGTGGTCCATCGAT
TTCCACCGCTTTCGTCTCCCGCCTTGCTAGCTCGACGAGCCCTGCTACCACTCACAGCTGCTGCAACGGAGGAATTTGAGATCGGGGACTTGGCTTTGGT
AGTGCTGGGAGACTGGGAAGCTCCTCGCCAAACGTTGCTCTGAGCTTTGGCTCGATTCATCTCCATGTACTGTCGCCGCACCAAAGCATACAGAGCGACG
CGCTAGTGTAGTCAAGAAATGTTAGCAACAATTTTAGATCGACTTACCCGAAGCCGAATGGTGAACGCTACACTTACCTGCTCAGGCAGCAGAGTCGGAG
ATTCAGTTGGTTTGTTCTCGGTTTCACTCTCTGTGTTCTCAGCAAAATCGTTGCTAAGAACCACTGAGCGTGCAATCTGAGTCGATTGAAGGAGTTCGTC
ACGAATTTGGGCATCTAAGCGAAAGCTCTAACCGCACATAGAGAGATACATTCACGTGTTATATTCATCAGAAGGCAAGGTAGAACCTAAAATGCAACAT
GTTACCTTTTCGATTTGATGGCCTAAAGGGCAGCTCTGGTCGAAACAAGTGTAAGACGAGCGAATTGAATCAGTGTGAACAACGTAGACAAACCTTTAGT
ACGGCCCTCTTCTGCTCCTTCAACTCCTGAAAGTATGGACGGGTCGAAATTCGCAACGCTGCTGTGCTTTCAGTTTGCTGCGTCGACTCTGTCGTCGAAA
ACAATTTTGCACACTTTGCATCCTACTCGGCGATGTAAGCTCGAAGCAGCACTTCCTCAAAAAGGCTTGGAGCCACGCACCAAACATTTCTGCGTTTTCT
GGGCTTCAAGGCGATTTTGTCGCTCTCGCGCTGTCACGCGCACGCAGATTTTGTCGTGGAATCGTTTTAACTCGTTCGACTTGACACGCAATCGGTCTTT
GCTCTCCTGCCGCATGGACTCTGCTTCGGCCTGCCCACAGTGTGTGGTGTTATTTTCTCTATTCAAACGCCATACCTCTGAAGGGAAAAGCGTGTGATCA
CCTCGACATCAACAACACTAAGGTCAAGCCAGTCGGATTCCTCTTCATCATCTACAAATCTATAATCTCCATATTTACCCCTGTAGAAAACAGAAACATG
TTAGCTTTTTGTTGTCGCCTACAATAATTCTTGAAATGGTTTACTTGTCGACATGGAGAGTGGGCATGGGAGGTGAAGGATAAGCTTGAAAGCGTGCCAT
GGACCGACATGGTGAGCAATTCTGTTAGAATGCAACGAGAAGTAAACATACCATAGTCTCTCTCTTCTGTGTCTGACGCATTCATTGCGACTACAATCTT
GAAAAGACGCACACAAAATCTGCAAAAGGTCGCGACGTTCATTCGTGGGTAGACCAGCATGCCAATGACACAGTACTATCATGTGCGCGATCCTATGGAG
AACCTACGCATTAGCGTGACAATACGCAAGGTCGGTAAGCGAAAGTAGCGCTGAAAGGGAGACGCTCACAGGCTAACTGGCGAAGTGACAGATCTCCGGG
TTCGGGAGTGATTCAAGTGGAGACTCGGTTCCCGTGGGCAGGACATGGAAATATTGCTTCCGGTGGCAGGAAAAAAAGCTTAGCATGAGGTGCGTGGATG
GTTGTACTGTCAGCAACAATAGCAATGCAACTGAGAGCAGTTCCTATTGCATTGTACAAGTGAAACGAAGCGAGAGCAGGAGAGTCTGGAGGCAAGGGGG
ATTCAGTTGTCGAATCGAAAGGTGTGTACAATGTTGCAAAGAATAAACGATGCAACATACAGATAGATTTTCTTTGAAAAAAATGCAGCGCGGAGATAGA
AACTTGCCCAAGATTGCCAACGCCGATATTTTATCGACATATGTCGATGTCGACGACTACGTTCCAAAAGAGGTGGGCGCTATAACTTTATGTTTTTACT
TGCTGCGGACTCAACAATGGGATGTACCATTCAAAGGAGCGACCAAGCACATCGATGAACACAACAACGCACCTCATTCCACCAGATCTCACTCGACGAC
CGCGAGACAGACGAAATGAATCTTCATGGACATCAAACCAGCATCGTGCGTGGCTCCGAGCAAACCGTGAAGATAAATTTCGCGCGATGCACATTGTTGC
TCTTATCGAGGAGGTGGAACGCGTGCTTTGTTCGTTCCGGTTTTACAAGGAAAGCGGATTGTTTTGTGCGACACCAGGATTTTCAGCGCCAATCGTCGAC
CCTGAAAGCGATCCAGACTTGTTCGTAAAGGGCCCCAAGCTCACCACGTTTCACGTGTCAACTCCGTCGGGCTCCCTCTATGAATACGTGCTAGACAACA
CAAATGACCTACTACCATTTGCCTCCGCTGAGGACCAACGTCTTGCACGAGAAATCCGCTTGCAAGAAGAAAAACGTGATACAACTGAGGTTTCTCGCTG
GCAACAACTGGATAACCCCCCCAAACTTGTCGAAGCAAGACCTGGTGGCTCTGGAAATACGAAACGCAAGTTAATGTTATCACTTGAAGTGGTGACTGTT
GATAATCCACAAACGATGAATCCGGTCTTTGTGGAGTATAAACTTGTACTACCTCACGGCATGGGTCATCTCGATTGGAAATTGCAACCTGGAAATTTCG
ACTGCAAACGGGGTAGGACGCCGCTATCGTTGCCTCAACAATCCCCATACACTGAATGTGGGTCTTCTTCGGCAGCGTTTGGATGGCTTGAACACTTCGA
CTTAAAACTCATCGATGTTGAGAAATCGCTTTTAGCAGCAGAAACTTCGTCCCAGGCAGCTAGAGATGCTGATTTCGGCAACATTATTCCCGCTCCAATC
CTTTATTTGAGCGTGTATTCACTGGATTGGTGGCGCCGAAAGCACACAGAGGGCCATGGGGAGATCGAATTGCAAGGATCCTCCGGATTTTACGACTTTG
ATGTGCCTATCCGGAAACCGATTACTTCCATTCGTGATCACATGGAGGAACTTTTTCTTGGCATCGGTGACAGTGACACCGACCAAGACTGGAATGCAGA
TCGATCCCATGACCGAGAAATCTGCACTGACGAATCTCCGATATCGACTATCATCACAAGCCGATTGGGGCAAAAGTCAGAGTCCACAGGCTCCACCGTA
CGAATTCGTTGGAGCATATTTGACCTGCGTCCAGCAACTCACGCAAACGGGATAGTAAAAGTAATGTCAGCAGCTTCTGTTGCGCCCTTGGCTAATACGA
AGGTTGTCAAGCGAAGCGTGCAGGAAATACTGCAATCAGTAAAACTGGAGAAGAGGTTGGCTAGTATACCAGATGTCCGTGTCCAGACGGCTCTGCGCTC
CGTGCCTGCCGGCGGAGTGGCAGCAACAGAATCACTAATAGACCAAAGTGCTCTAGTTTAATAGCGACGGCCGGGAACGACCTCAAAAGTGTATTGCGTA
GTTGAATCGGACAGACAAACACGCTTACTCATCGTCACTGTCCAGATCGTCCAGCGGATTGCCGCTGCGCTTCTTCATGACGCGGAAGAATTCCTCCTCG
TTAATGAGCCCGTCTCCATCGCGGTCGGCTTCGTCGATCATTTCTTGCATTTCTTCGTCCGTCAGCGATTCTCCTAGTTCGGCGCACACGCGCTTCAAGT
TGCGGAAGGAGATCTTGCCCGTGTTGTCGTCGTCGAAGAGCTGGAAAATCTTCATGATCTCCTCACGCGAGTCTCTCGAGTTCTGTCAGAGGACACCAAG
AAGACAGTAAACCTTAATACATCGAGCCGATTCTCCCCTCATAGTCATTGCAACGAACCATTTTCCCGGTCATCATCTCGATGAACTCGTCCTGGTTAAT
CGTTCCAGACTCGTCCTTGTCGATGTCTGCAATCATCTGCCGGATCTCTGCCTTCTTCACCTGGAACCCCAGTGCCCGCATTGCAGCCTTGAGCTCACGC
ACGTCGATAGAGCCACTGCCGTCCGTGTCGAAGAGATGGAACGCCTCCTTGATCTCTCAGGTCTTCTTCGTCCAGCACCTTCTTTACCGGCTTGGGCTTG
CGGCGCAGCGCAGCGCGAGACCGCGCAAAAGCCGACGCGGACATGGTATTCGACTACCACGAAGCACAACATCAGTCCGTCAAATGTACGTCGTCACGTC
AAGCATGACGCTAGACAAACGTACCATTTCTCCAGCGAGCAGAATGAAAGTGTCCGTTGCAAACCAATGGCGACCTTTCGGGTGCACACTTCAACGTGGA
GGTTCTACTTTAATGACCGAACCTCTTTCGTAAATTACAGAACCCGGTTTTCTATTCCGGTTCGTGGGTCAGACAACTTCCTTCCTGCCGTCACACTCTT
CAATTGACCAGCACGCACTCACTTCCTACGACCTTTCAGCGCGATGCTATCGGCAGCAGCGAAGCGTATGCGACAGAGCACCATGCACACGCTCAAGGCC
TACGACAAGAGCGAGCACCGGCTGCTCGTCGTGGGCGCAATGGCTTCGTGGGCAGCAACATCTTGCAGCGCGCCGTGCAAAAGGGCATCGAGGTGCGCAG
CCTTAACCCGTCGGGCAAGCCGCAGTGGCAGGACGTGCCGTGGATCGACCAGGTGGACTGGCACGAGGGCGACGTGTTCGATGAGAAGCAGCTGGCCAAG
GCCGTGGAGGGCGTCACGGGCGTCAGTACGTGCAGCTCTCCACAGACTCGACGTCTTTTGTATTGACGACGCATGGTTGCTGTTGTTGTTGTGTAGTCTC
CACTGTAGGCGCGTTCGGCAGCAACGAACTGATGGAGAAAATGTGTGGAGACGCGACGATTCTGGCGGCGAGAGCGGCGCAGAAAGCAGGCGCGGAGAGA
TTCGTGTTTGTGTCTAACTCGCGCGTGGGCTCGTATTTCCCGCCGTGGCTGCCGATGCATGGCTACTACAATGGAAAGGAGAGAGCCGAAGCTGCTGTGC
ACGCGAGGTGAGACGTGAACTGACGGCATCTATTGGGTTTATTCTGTTGCTGACAATTTTTCGTGCACTGTCAGATTCCCAAACACTGGTGTGTCGCTGC
GTCCGGGTTTCATCTATGGATGGCGCCGCACGAAGAAGGGTCAAGGGATTCCGCTGCAACTTGCGGGGCTCCTCTTTCGACGCTGGCACGCGACCTGGGC
ACAGTTTCAACAGCGCTGGGCTATGTGCCGTTCGTTGGTGAGGAAATGAAAGCTGCTATCCCTGTAGGTGCCGTTGCCAAGGCTGCAGTGCTCAGTGCGA
TCGGCCCTGTGCACGGACAAACGCTGGACACGACGAGCATGCTCGAGATCGCTGCCTCTTTCCACGTCCATGAATAAGAGTGCGATGAACTTATCCAGTC
GACGAGGGCAATGAAATCTGGAACTAAATCAATTCCAGCGACAATACCATAAGGCCAACCTCCTAACTCCAAAATTGACGGGTGAACTCAAGGAGGGTAT
GACAAAGCTTTCATTACCGCGTTTATCTTTTCGCCATCGCCTGAGCTGTGTACTTCATGCCTATGACACCGATTTTCTTTTTGCGATCTTCTGCTTCTTG
TCGTCGCTTTGCTAATTCCTCCGTCCGATCCTTCCAGTATTGCTGTGAAGATAAACGCAACCATTCCATAAGCCTCACGGATATCGCTGTTGCAGCTCAA
CAGTCATGGCGTACCTCTTTCTGCTTCTCCTTCTGTTTCCCCAGATTTTCGTTCAAACTCTTCGCGTCAGCTTCATTTTGCTCTGCTTGACCAGGTAGAC
AAAGCTCTTCCAGGGTCTGCACCCAGAGATCACGGACGCTTGTCGCTCCAGCTGTGAGCTCAAGCAGTTTCTGGCCATTCTGCCCGAGCAGTACTAGATC
GAGACGACCTATGCTCACAAACGGCCTTGTTAGCAACAACACGAACCAGCAGAAAATGGCTGTACGTGCCGTACCCATGGGACACACTTTGCCAATCTTG
TGAATCGGCAGTTCCTCCGAGTTACTTGGACCGGGCGTCTGGCGCCACACGAGCCTGCCGTTGATACAGATACTGGTTCAGTGCTCGCATATCATTCAAT
TTTGCCGTTCTAGCATCCTATTCAACCTCGTAGCTGACGGGTTCAGCTGTAAGTAGACACTTTCTGATCTGCTGAGCACCCCCAGAAAGGAACTCTTTTT
CTTGAAATCGTTGCCTTCTTTGAGCAGCTCCTGCCTCGCCAGCATCTCCGAGTCGCCACCACCGCAGCACACATTGCCCATGTCCTTTCCTCCTGTAGCA
GGGACTCAAATCAAAAATACAAGTCGACTAGAATAGGTTGACAAGCAGTGTGGAGTGCACGTGTATTTCTCAAAGCTTGTTGGAGAAATCAAGAATGAAA
TCGATACAGAACAGCTTTTCTCGCTGCTTGGCGCGGCCTAAGCGATGCTAGACAGAGAAAGTTGTCGGACAACATAGAGACGTGATGCTTATTTAGCGGC
GCAGAGACTTGGTAGCAGACTTGGCAGCGCAACCACCACCCGAAGTCGGGATAGTGCTCGAGCCCCATGGGGAACCCTTCGTGGCATCACCCGCACCACT
GGTAGAGCTCGCGGGGGTAGCAGAGGAGCCCCCGGTTGAGCCTGCTGCGCTCGAACTGGCATCGGAGGAGCTGGGAGCAGACCACCCAGTGCCCTTGGTG
GCATCCGATGCTCCCTTGGTAGCATCAGAGGCTCCAGTGGTTGAGCTCCCTGCACTCGAGCTAGCATTCGAAGACGCAGGCGAGCTGGCAGCAGTCGACC
CAGCGGCGGAAGTGGTGGAGCTAGACGCACCACCTTTCGAGGCGCACGTTGTGGCCTTGCCCGGAGTGGTCGTGAAAGCCGTCACCGTGAAATCGGGCTT
ACCGCCCTTCTTCCACGTGCAGCACGGGTCACCAAACGCTGCACCGTTAGTCATGCTCGAGCTCGGGAACTTGGCTTGGCACAGACTGCTGGACCACGTG
TGACCGGCAGCAGCAAACGCTTGAGCAAAATCCGTCGTCTTGGAGCTGTCGTCGCCAGGGTGACCGAGTGCCTGCTGGAAGGAGGTGCCGTTCGGAAGCT
CGTTGAGGTACTTGGCGAGACCCATAGCGGGATCCACCGTGGCGGCGATAGTCAGAGCAGCAGCGGCGATGGCAACTTGGATCTTCATCTTGGTATGGCG
TGTTCTGGTTCTGGCGGTGCGAGGTAAATTCAGGAGTGAGAAGTGAGAACTTACCCGTGTTGACTTTTCCGA