Description :
From Genome Similarity Track
Location :
Scaffold_29:184612- 186252
Transcript NameFunction/comments
Aphas_H257_10240Hypothetical protein

Sequence
1640 bases(100 bases per row)
CAAATCAAATCAACTGGGACAAATACTGGGGCCAAACGATCCTGAACTATGATTGGTTGAAATTTAGGATTATTGGAATTTCATTGGCTAGCCGATTGGG
CTGCTACCCACTTCAACTTCGAATCGAATGCATAATACTATTTTTATAGTATAATACTTCGTACTTCGTATTATACTCCGAGTAACGTTTGAAGTATTTT
GAGCTTCGGTTGTTCAAAGTTATTAATAACGCAGTTAACAGTAAACAACGGTCATATTACGCAAAAATAAATTCTAAATTGACTTAGTAACAATAGTACT
CTTACTAGCTGCTTCCTGTAGTTCGAATGAGTGTTTGTCGTTGGAGTCCAAAGCAAAAGTATCATAACCTTTGCCAGTGCGAAGTGCGTACGATTTGCTT
GTTGAAGCCAAAATGTCACTCGTATTGTCTTAGGGTTTCTAGCTTGCCAACATATTGTTGGAATTGCCACACAATATTTATAATAATATTTGTCTCACAG
ATTACAAATTGGAGGATATTTTAATGCGATCTATTGTCGGTGCATCCAGCGATGTGATTGGCTTAAATGTTGCCACTCCACCAGACACATCATCCCACCC
GTTCGTGTCCAAGGGCCGCAGGTGTTGCTGTCACATGAGCCACTTCGCACAACGAGCGATGCTGCTGGCCCAGAACACCGCCAAGCAGGCTGCCAATCTC
GCGGCAAATCCGTCCCCTTCCATCGCGGCGCCGTCGGACGATGCTGACGAGTTCAAGTGGATTGGTCTGGCAATCGTCGTCGGGTCGGCAATCCTGTCCA
ACCTTGGCGTGAACGTCCAGAAGCTGTCCCACGTCAAGGAAGAGAAGCGATCGTTGTTTCTCCGTCGACCGTACTACGTCCGTCCTCTGTGGATCATCGG
CATGACGTTCGTCGTTCTTGGGTCGATCGGCGACTTTGAGGCCCTCGCATTCGCGCCGCAAGCGCTCGTCGCGTCCGTCGGCGGCGGCTGCACGGTGCTA
GCCAACATGGGTTTCGCGCACCTGTGGCTTGGCCAGCGTCTCACATGGTACGACGTCTTTGGAACGTTCTTCATCCTCGTGGGCGTCGTGCTGAGTACCC
TCGCCAACACCCCCGACGCGCAACTCGACCTGAACGAGCTCGAGCTTCATTTCCGCCACCTCGAGTTCCTCGTCTACTTCTCCGTGATGGTATGTAGAGT
ATTGTTGGGGCCAGCCGTCCTCAACCGTGGCTATCTTCTATGGTAGTGCTTGATTTTGTTCATCCTTTTTGGCGAAATCCGGTCCATCGCTCGGCATTCT
CGGCCGACCCACGACCATTTGCATCGCCGGTTGGCGTACTTGTATGCGACAGCGTCTGGGATCTTTGGGTCGTTTTCGGTCTTATTGGCCAAAGTAAGAC
ACTACACAAATAATTCATGGATATGTTTGTTTTCAATATATATATATGTGTATCCATTCTATCTCTCTTGAAGGGTCTATAGAATTAACCTTTGTACGGA
TATGTAGTGCACGTCCATGTTGTTGCTGTTAACGTTTCAAGGCGACAACCAGTTTGTATACCCCATCACATACCTCTTTGTGGGTGGTAAGCAGCCTCTA
CCTTGTCCAGAATGATAAACCATTCTAGTTATAACATCAA