Description :
From Genome Similarity Track
Location :
contig_5:184611- 201683
Transcript NameFunction/comments
g1648.t1hypothetical protein
g1649.t1hypothetical protein
g1650.t1hypothetical protein
g1651.t1hypothetical protein
g1652.t1hypothetical protein
g1653.t1hypothetical protein

Sequence
17072 bases(100 bases per row)
GTTTCGGTCTGTGCCACTCAAAGCCGCTCCAACGTGCGGTTGTCGACTTTCGTCTCCTCTTGCAGTGATTTGCGGTCGAAGACCTCATCCTCCTCATCGC
TGCTGCTTTGGTCATCATCATCATCGTCTGCGTCAAGCCGCTGGTGTTTCGCGGAGCCCTTCTTGTCATTGCGAACCATCCCAAACTCTTCCTCGTCGTC
GTCATCCTCATCCTCCTCGCTGCCTTTCACGCGGCTCCAGAGCTGGTCCTTGCCTGTCTTTTGTCTCCGCCGGCTGACCGAGATCAGCATCATCAGTAGA
AAACCAACCACTAGAACTGCACCCACGATCGTGAGCACCATTGGGTGGGCGCCACCTGACGATTTTTCCTTCGCTTTCGGGTCTGCGGCAACACCTGACG
ACGACGACTGAGTCTTTGTCGTTCCTTCTTCCGACAATGGCTGAATATTCAAATCCGCCGTACTAGAAGCAAGGTCCAGAGTGGAGATATTTGCTACCGT
CGCTTCTGGAGTCGATGCAGCCGTAACAGTTGGTTCCGAGGCAGCTGCAGCGGAAGTGGGCTTCGGGGATGATTCTACCGTTGCTTCCGTAGCTGAAGGG
ACTGTTGCAGCATTGGTAACAATAGGGACAACGTTGTTCGTTTCACCATCAATGCTACTCGTTGAATCGTTGCTGATGGACGGGGAAGCTGTTGTCGAGG
AATTGCTTTGGTAGGCACAGTCTGCGTCCACAAAACCCACTCGCTGGTTGCCAAGGTCAAAGATCACATCACGGTTCATCATGAGATTGGCGCCAATGAC
ACCACCAGAGTTCTCTGAGAGGTAAATACTTCCACAGAAGGCACCGTTTGCGTTGAGGAGGTACTGCTCAGGCGGCACATCCAGGACAACTTCAGCATTC
TCATCTCCATACGCTTCCATCACAAGCTGGATCGTGGGTAGTGACGCCATATCCTCGTTCGTGAAACCATGGCACGATGTGCCCACCTGGTAATCACGGC
CCGCGACTTCCTTAAACATCTGCAGAAACTCGGTCTTCAAAGCGCGGGGGAGGTACGAATCAGTAGTTCCGCTGTCCACAATATAGTGGCCTCGCGTGTA
TGCCTCTTCCTTGGCGTTAATAGACTTGCCCCCGATGCGAATGTCCTTCATGTGAACATTGTAGAAATGGCTATAACACATGGAACGAGTAAACCATTAA
TAAAAAACTCCACAGCGGAGCAAGCAAGCCAATTGTACCTGGCAGATCGGTCAGAGATTACTTTCGCGTAGGAAATTTCACCTCGGTGTGCATTTGTGTT
CGCTTGTCCAACCGACATGGTTCCGCCTTGATCAGTGAAGCAGAGCGAAAACAAGTTGCTGGGAATTTTGTTCTCGCGATGGAGCTTCGCAACAATATGG
TTATCCGCGTTGGACAATCCCATGATGCCATCCGCCACCTGAGTGACGAACAACCCCGTTTCCGAGCTCTGACATCCGAACTGGAAATGCGTGCCGTAGC
GGTTGCGCATCTCCTCATCCTGGAAGCTCGTTTCTCCTCCCAAGTACACGACATCCTCGACCACAGAGGCCTTCCAGCTGCTTCCCTCCATGTACGACTG
AGAGATGCCGCACGTGTCCGATGTCTGCTTGCACTCCTTACACTGAAGAACGACTGCTGAGAGCACGTCACATGCACCAACGTGGACGAATTGTCTGCCA
TGAAAGGTTGGTCCGTGTGGCTGCCACATCCGTCGCACCCCGAGCACGGGAAGGCCATGAGTCCACTGCCTGTGTCCGCGATCACCGACGCTCTCTGAGG
CGGGGTACCAGCATATACCCATGTGTAGTGCGTTCTGGATCAAGCACACGGCTTCATTAGACCCCCCATCCATCACCCAACACTGTAGCAACGCTGCACA
AGGCAGGATCAACGTACCCAAGTCCCAAATGCAGCGGCACGAGCTCCGGCGCGTCTTCTTCGATGTTCAGACGCCTCGCGTATCTCTCGGGGTGAATCTC
GTGCTGCGGCAGGCGGTGCAGCTCCATGGTCATGCCAGCGGATTGTGCAGCCTCCGCCAGAGTAGTTATCGTCGAAATGGCAGCCAGCAACACCGGAATC
CTGCGTACACGTGCACCATCTTGAGTCTCTGAGTGTTGAGCCCCCTGTGTCAATTCTGCGTCGTAGGCGGTGGTTGGACGCTGGGGATCTCCCTATCGAA
CTGGGCTACGTGATGGATGGGTGCTGGGCAGTGGTACCGGTACTAACCACACAGTGTGAGGAAGAGGGTCGCCGATGGGAGAGCGAGCGCACGTGGCAGT
TTCCTCCTCAACGTCTTGTGCTCCCTATTTTCGCTGAAACGACGACCCAATCGTAAATGTGAAACGATCCCAAATCGTACTTTGTGTTTGATTTAGAATT
AGTTTGGGTCCCGCAGCACGCACGAAAGAGCCGGAAAAAGTATCTTTCAAGTGCTGACTCTCTTAGTCCGTGAGCGCCATTTCGTGGCGCAGTAGCGTCG
ACCACGCGCTGGTGTCACGGCGTTGGCGTTGGCCAGGAGAGAGCAGCTCATTGCCGTCGTCGAACGCTTTCTTGGCGTTTGGCTGCACCGAGAACGCCCG
CAACGTGGTTGTGGAGTCAGCCATTCGACTTGCCAGGCCCACGAGGGGGATGCCAAAGCGAGAGTGAGGTGACCAAGCACCGCGAGGTGATGCAGCAGTG
ATTGGGTCCTTCTTGGCGTTGTTCTGAACAAGAATATCATGACGGATTTCGTCCAGCAGCTGCTGGCATTTCGGAGACACGACGCGCCGGGACTCCATGA
AGACACCCGTGTTGGGCTCAGTTGGCAGCGAGGCTTTCATACTGAGCAAACGCTTGCGGAGGTCATTCTCACCCGGTCGACGATGCTGTGCCAGTAGGGC
GGCAGCTTTTAATTCCACTTGCGAACCGTCGGGATGGCCCCCCTGATTGCTGCTGCTGAAATGTCGCCTTCACCCGTAGCAAGGTCGGCATCCCCCGACA
CAAATGAAAGGCGGTGGTGTGGAGTGGCTAGCTGCTCTGCAGACATGACGCGAAGTTCACCTGCAAGTTGTAAATCTGCTTTGACTTGCTCAGCACTATT
GTTCGACCCGTGCGCAAACGGAGGGAAGTCACGCTGTTCCGCACGGAGAAGTTTGTGTTGGCTCCAGGCAGAGAGGAACTCCACGGCTGGAAGCAGCGTT
CGGTGATCCTCCAGGCTTTCATCCACCCAGTCGATTTGCTGTAATTGTCGTTCAAACTCGAGCGCTTCGCCAGACAACACGCGCGTTTTAACTGATACCG
CTTCATCCAGGTTGCGGAGAGCACGTGCACTGCTCCTTGATTGCGGCTGCGACGTGCGTCTTGTTGTCTTGCACGGCCCGTTGAACCCTGGTCAGAAACT
GTAGCTTGTTCTCGATCACAGTCTTGCGGGATGTGATCAGTGGATCAGGACGCAATGACTCCCGTAGACAGCTCTCGTACGCATCTGCAACAGTCAGCAG
GCGATGCGAACCTTTCTCTCCAATCGAGTGGTCTCCAATCATTTTGCAGCTCACGCACACAGGAACCTGGCACACGGGACAATAAAACTCCACTTTCTTG
CCACGGTGAGCGGCACGTTGGTGTCTGTGTATCATCAGCCAGGAGACCTTCTTCCATTTGCTTTACAACGATCTCGTTGATGTGAGCCTCCGTCGGCTCC
GCGCTGCTTGGCGGGTTCACGAGACTTTCCACGCCTACTTCCGCAATGGCAGTAGCAAGAGATGGCGTTGAGCTTCGACGTCTGCCGCGTCTAGCACCTC
CGCTTGCTAAAGCTTTTGATTTACTGCGCAGAGGCGTACGCTTGTGTCGACGTACCAACTTGTTTGCCGAGTGGACTTCTTGGTCGCAATGAGCACAGAT
CTGTGCCTCGCAATTACGGCAGACAACAACAGCGGGGTGCTGCTCACATAATGCACATGATCCCACGGCTGGACCATGTGCATCGGCTGCGGAGAAGGTG
AATCGCACGAGGTACTGGGGCAAGACCTGAAGTGTGTTGTTCAAGATGTACTCGTGGTAGTAACCGCGATCCAGCAGTGCAGACTGGAGATCACGCTCCT
GCTCCTGCTCATTCGAGCTGGAGCCTTCATCACGGTGCAAATAGTAGCTGTGGTAACCAGGTGGAAGGCGTGCTTTGGCCTCTTCCTCTTCATGAATAAC
AAGAGATCGTCCAACCGCAATCTTGCAGAGCACGAGCTGCCGCGTACTTGATGGCTTCTTTGCCTCTGCTGGAGGCTCCGGAGGAGGTGGAGCACTGAGC
TGAAGGTTTCCTGTGGTGAACTTCATCCCCGATTGGTTGGCATCGAGCGATGTGAAGCCGTAGCTGTGGACGTCACCCATGTCAGTGCCAAGGTCGTTTA
CGGCGACCCACGACTCGAGCTCTAGCAATCCTGCCGTGTGCTGCTCATACTGTGCCACCAGAGACGGATTGCGCATATCCCAGATAACAACGCCCTCGTG
CACACGATACCCCGGCAACGAGCACTGCAGCAAGTACCTCACGCGTGCAAATTCCTTGGAAGACTGGCTCATCGGCGTCACACTTGCCACTGCTCCTGCG
GCAGGAATGGTTGTCTGCCCAGCTTCGTCTTCTTCGTCATCCACTAAAACTTCAGGATGTGACCCCGTTTCGACGCCCCATTCAGAGTATTCGCCTGGCG
GTGCTGCTGACGAGGTGACTTGCGAGCTAGCGTCGTCGGAGCCTTCATCTTTTTGAGCCCCCTCCACTGGACGCTCGGGTGATGCAGGCCGAGCAGCCTC
GCCTGGTCCATTCGGGGAATGCGACGACAAGAACAGCCGCAGTCGCGCAAGCGAGGCACTTGCCTTCGCCTCGTCGGCCTCGTTCACTACCATTGGTACC
AGAGTTCAGCCAAGGAGATGATCGTCGGTGCGTTTTAGATGCCGTCGTTTCGGATGTCCTTTCGTGAATTGCGTGAGTACAATATTGGATTGAGCTCACG
AGCTGGGAGCTGGGGTGGTGTATCTTCCTTCACTTGCAATTTTGCCGTGCGGCCCAATCGCAGTCACCCCGATAGAGCAGTGGACCATAGTCCATGAAGC
GCCACGCCTTCGCAGTGTGCTACTAGTAACGTAGTCTTAAACCGACTGCACTACGCTCATATTTGCTTTAAAGCGGACACAGCGGCAACATCGCTAAGAG
CAATGCAATGCAAAGCGACAGGCACCATAAGCTCCAGCTGCAAGCAATAGGTCCTCGCCGCAGCAATCCGTTGACAAAACGGTCGCGGTCGTTCGAGATT
GCTGCAGCAGCCCAAGGACAACCAAAAACTCACGTCGCAGCATCAATTCCGTGCTGCAAAGGACCATATTGCAGATCTGGTCGCTCCCAGTCATCGGCAC
CAACTCAAATCGAAAGCGCGCCAATGGGACACTCAGTTCCCGCCACCTCCAGCCGTCCAACCAATTCAAATGGCCGTTCTCTCTCGCGACCAAGCGGGTT
TCCTTTACGGCCCGTTTTCAATACAAACCCAAGTCAAATACGGAAATGGGCCGTAATTTTGGAACCCGTAGCTCTTCGAGTCAAAAAGGCGTGCGCAGCC
ATTCGGCCATTTGCTTTGTCTACCCATACATCCCACCATGAAGTACCTGGCAGTGACCGGCGGCACCGTGAGCGGCCTGGGCAAGGGCATCACCATCAGC
AGCATCGGCGTCGTGCTCAAGTCGCTGGGGCTGCGCGTCACGTCCATCAAGATCGACCCGTACCTCAACTGCGATGCCGGCACCATGTCCCCGTTCGAGC
ACGGCGAGGTGTTTGTGCTCAACGACGGCGGCGAGGGCGACTTGGACCTGGGCAACTACGAGCGCTTCCTGGGCATCACGCTCACGCGCGACCACAACAT
CACCACGGGCAAAGTCTACACGCATGTGCTCGAGAAGGAGCGACGCGGTGACTATCTGGGTAAAACGGTGCAGGTGGTCCCCCACGTCACGGACGCCATC
CAGGACTGGATCGAGCGCGTGGCCCAGATCGGCGTGGACGGCAAGCACGCCGGCGAGGCTGCCGCTGTGGACGACGAGGCCGCCGATGTGTGCCTCATTG
AGGTCGGTGGCACGGTCGGCGACATTGAGAGCATGGTGTTCCTCGAGGCTCTGCGTCAGTTCCAGTTCCGCGTGGGCCCCGAGAACTTTTGCCTCGTGCA
CGTGTCCTTGTCCCCGTGCTCGGCTCCGTGGGTGAGCAGAAGACCAAGCCCACACAGCACGCCATTAAGGAGCTGCGCAGCGCCGGACTGTCCCCCGACG
TCATCATCTGCCGCAGCAGCACCGAATTGGAACCGGGCACCAAAGCCAAGATCGGCATGTTCTGCCAGGTGCCGGCCAACCACGTGCTGTCGGTGCACGA
CGTGAGCAACATTTACCACGTGCCTCTGCTGCTGTCCAAGCAGGGAGCTGCTAGCATTCTCATGTCCAAACTGCAGCTGATGGACCGCTTCTGCGAGCCG
GACCTTGAGGCCTGGTCAGCCATGGCCCACCGCGTCGATTCGTTCGAGCAGGTGTGCAAGATCGCGCTCGTGGGCAAGTACACGGGTCTGCAGGACTCGT
ACCTGAGTGTCATCAAGGCGCTCAAGCACGCCACCATGAAGTGCAACCGTGACCTAGAGATCGAGTGGATCGAGGCCAGCGACCTGGAGGTGGACATGCG
TGAGAACGACCCCAAGGCCTACGAGGAGGCCTGGCGCAAGCTGCGCAGCGTGGACGGTATTGTCGTGCCTGGCGGTTTCGGTGACCGTGGTGTGGACGGC
AAAGTGCTCACGGCCAAGTACGCTCGCGAGAACCGGATTCCGTACCTGGGTGTCTGCCTGGGCATGCAGGTTGTTGTGATCGAGTTTGCGCGCAACGTGA
TCGGCTGGAAGGAGGCTAACAGCGAGGAGTTTGACGCCGATGCTGAACACAAGGTGGTTATTTTCATGCCTGAGATCAACCCGGAGGTCATGGGTGGCAC
TATGCGCTGCGGTGAACGCCGCACGATTGTGCACGAAAAGGAGGACCCGGCGAAGCGCTCGCTGGTGTCTTACCTGTACGGTAAGGACAAGCCGATCCTG
GAGCGTCACCGTCATCGTTACGAGGTGAACCCGGAGCTTGTGCCCGCCATTCGTGAGGCTGGTCTCAACTTCGTCGGCACGGACGAGAAGGGCGAGCGCA
TGCAGGTCGTGGAGCTCGACCGCGACGTGCACCCGTTCTACTTCGCCACGCAATACCATCCGGAGTTCAAGTCGCACCCGAGCGACCCGTCGCCGCCGTT
CCACGGCCTCATTCTCGCTGCCACCGGTCAGCTCGCCCAGTTCATGAAGGACGTGGAGGCCAAGGAGCAGGAGCTGTAAGTGCTCGGGCGATTCGAGCTA
GAGGCGGTGGAAATTGCTGCGACGCAGAGCAGGTGGACAAGTGGCGCGGCAGGACGCAACGACGATGCCTCTCTCGCAGCAGGTTTGCGTGTGAATAGGC
TAAAATATTGATTTGGACCCCTCCACTCCGATGTCTTTGCCTTTGTTTTTCTTCGTCGAAGGAAAACGGGGCGAAGCTCTCTCGGTGGGGTTCCGTGACC
AGCCCACGGTCAGGTAGAACTAGCGTTAGACCAATAGACATATATTTATTCCAACTCAACCGTCTGATTGTCCGCATGAACGCCAGCGAGCCCAGCACTA
ATGCTTCGGCCACATCGTGCTGACGCACTTGGTCCAAATGGCTACATCTGAATTTGCTCATTTTCGGCGAATCAGAATGCTTCGAGTGGCACTCAACGTG
GCATTTCCGAAAATGTCTGAAGAGCTGCAGGAGGCGGTGGATGGCTTCTTCCTGGCGGCGGAATACGGCCGCTCCGACGTCATCAAGGCACTGGCGGACC
ACGGTCGCGGACGCCTGTCGCTTGGAGACGTGGTGGATCCCGTGACGGGGCGCTCGCCGCTGCACGTGGCCGTAGCGAGCAGCAAGAAGGACGCGCTGCG
GGTTCTGCTGGCCGCTGGCTTCCCCCCGCACCATCAGAGCAAGCAACAGGAAGGAAAATACACGTTAGAGGGCGAAAATCGGTCGGCGTACGCGCTGGCG
CAGCAACTGAAGTCGCATGATTTGCTGCTGGTGTTCCACCAGTTCCTGATCCAGCAGGTCGCGGCCAACGACGTGCAGAGCGTCACACAGTTACTGACGG
CTGGCGTGGATGTCGGCGTGACGGATACAGCCACGGGAGGATCGCTGCTGCATTGGGCGGCGTCGTGCCAAGCAGTGGAGGTGATGAGGGACCTGCTGGA
GAGAGAAGACGTTCAGAAGCAGAAGCTCGTGGATGCTCGCAACGGGGAAGGAGCGACGCCACTGCACTTGGCGTGTCATGCGAACCAGGTGGAGTGCACC
AAGCTGCTGCTACTGCATCATGCTGATATAAGTGTACGGGGTGAGAAGGGGGTCAGTAAGGACAAGACGGCGTTGGAGCTGGCTACGATGGCGGAGGTGA
TAGAATTGTTCTCTCAAGGGCTAGGAGGGAAGAGTGAGGTCAGCGAGCCCAGGGAAACGCAGAGGGAGGCTTCAAAGGAAGGAGATAAGGATGCAAGCAG
CAGTGATGATGTGTCGTGCAGATTGATGACGGTTGGTGGTGAGCGTTCTGGGGCCTGCCCACATGAAGCGCAGAACAGCAAACTGTTGCTTCAGCTCGAA
GAAAAGGATCTCCTGGTAAATCAGTTGAAGAAGACTATTGAAGTTCTCGTGCAAGAATCACAGGAAATTCAAATGCTCGGAGAAGAGCGTGTGATGCTGG
ACTATGTGCGCAAGCTGCGCGATGAGAAGGCTATTGCCCAGAGGCAGATTGAGGATGCGAACGACTACATCAAGGACCAACAGCAGCAACTCGAAAGCTT
GAAGGAGCAGATCCGACAAACATCCAGTGCCACCAAACAGGTAAGAAGATTGTTGCTGGCGTTAGTTGGCTGAAAGTGGTGTTCTTACGACTACTTCTTT
TATGTAGCAGCTTGAGACTGACCACGACATTCTCTCTCATACTAGTGATGGTACGGCTAGCAGCGTCGCTGGGGCCCCTCCGAATAGCTCCAACAGCAAC
ACGAATGCGCTGGATTTACACCAGCTCGATACACAGTTTGATGAAGAGGACGAGAACTCACAAGAACCCCGAGCTCAAGCACTGAAGTTAGATGCCTGGA
CATCGAAGGCTCAACGTGAGCAAGAAACATTCAATCGATACGTCGAAAAGCATGGTCCTGACATTTGGAGTACGGTGTGGAACGGTATCTTTACAGGCAA
TGAAGAGAAGGAGACGCACGATGAAGACGGCGAGGTCATCATGACGGTGTAGAATGAGAAACAAAGTGAATTGAATGATTTGCATCGATGGAAACCCAGC
AATGATTGTATCCCGCTACCGCATTGGCGAGGTAGCAGCTGCAGACGTATCCTGCTGTTGCTGCTTGTAGACGCTTACGAGAAGTTTCTCCCGCTTCTTG
GGTTGCTTGTATAGTGCACAATTGTTTGCGCACAAGTGTGGCGACGAGATTGAATTTTGTCCATCCTTACCACACGAGCAAAGAGCTGGGGTCCCAAGTT
GCGCTTGAAGTGCACGAACATAGCGCTCGTGATCTTTTGTCGCTGCTGATCTCGTTGCACTCTTCGTTTTTTTCCTTGTGAAATTGCAGTGAATGACTAC
GAGCAATTCCAAGGTGCATGGCAGTAAATGTGTCTTACCTCCACGGAGTCGACGATGTGGTAGTCTGACGATGTGCTCGTGCCTCACATCCCGACGATAT
ATCAACACTGGCCACGACAACGTTAGCTCCAAACGGACCATACCAAAGAGAAGGACACTTCCCACGCACACTTCGACACCCGCGGAGGTGGTCCATCGAT
TTCCACCGCTTTCGTCTCCCGCCTTGCTAGCTCGACGAGCCCTGCTACCACTCACAGCTGCTGCAACGGAGGAATTTGAGATCGGGGACTTGGCTTTGGT
AGTGCTGGGAGACTGGGAAGCTCCTTGCCAAACGTTGCTCTGAGCTTTGGCTCGATTCATCTCCATGTACTGTCGCCGCACCAAAGCATACAGAGCGACG
CGCTAGTGTAGTCAAGAAATGTTAGCAACAATTTTAGATCGACTTACCCGAAGCCGAATGGTGAACGCTACACTTACCTGCTCAGGCAGCAGAGTCGGAG
ATTCAGTTGGTTTGTTCTCGGTTTCACTCTCTGTGTTCTCAGCAAAATCGTTGCTAAGAACCACTGAGCGTGCAATCTGAGTCGATTGAAGGAGTTCGTC
ACGAATTTGGGCATCTAAGCGAAAGCTCTAACCGCACATAGAGAGATACATTCACGTGTTATATTCATCAGAAGGCAAGGTAGAACCTAAAATGCAACAT
GTTACCTTTTCGATTTGATGGCCTAAAGGGCAGCTCTGGTCGAAACAAGTGTAAGACGAGCGAATTGAATCAGTGTGAACAACGTAGACAAACCTTTAGT
ACGGCCCTCTTCTGCTCCTTCAACTCCTGAAAGTATGGACGGGTCGAAATTCGCACCGCTGCTGTGCTTTCAGTTTGCTGCGTCGACTCTGTCGTCGAAA
ACAATTTTGCACACTTTGCATCCTACTCGGCGATGTAAGCTCGAAGCAGCACTTCCTCAAAAAGGCTTGGAGCCACGCACCAAACATTTCTGCGTTTTCT
GGGCTTCAAGGCGATTTTGTCGCTCTCGCGCTGTCACGCGCACGCAGATTTTGTCGTGGAATCGTTTTAACTCGTTCGACTTGACACGCAATCGGTCTTT
GCTCTCCTGCCGCATGGACTCTGCTTCGGCCTGCCCACAGTGTGTGGTGTTATTTTCTCTATTCAAACGCCATACCTCTGAAGGGAAAAGCGTGTGATCA
CCTCGACATCAACAACACTAAGGTCAAGCCAGTCGGATTCCTCTTCATCATCTACAAATCTATAATCTCCATATTTACCCCTGTAGAAAACAGAAACATG
TTAGCTTTTTGTTGTCGCCTACAATAATTCTTGAAATGGTTTACTTGTCGACATGGAGAGTGGGCATGGGAGGTGAAGGATAAGCTTGAAAGCGTGCCAT
GGACCGACATGGTGAGCAATTCTGTTAGAATGCAACGAGAAGTAAACATACCATAGTCTCTCTCTTCTGCGTCTGACGCATTCATTGCGACTGCAATCTT
GAAAAGACGCACACAAAATCTGCAAAAGGTCGCGACGTTCATTCGTGGGTAGACCAGCATGCCAATGACACAGTACTATCATGTGCGCGATCCTATGGAG
AACCTACGCATTAGCGTGACAATACGCAAGGTCGGTAAGCGAAAGTAGCGCTGAAAGGGAGACGCTCACAGGCTAACTGGCGAAGTGACAGATCTCCGGG
TTCGGGAGTGATTCAAGTGGAGACTCGGTTCCCGTGGGCAGGACATGGAAATATTGCTTCCGGTGGCAGGAAAAAAAGCTTAGCATGAGGTGCGTGGATG
GTTGTACTGTCAGCAACAATAGCAATGCAACTGAGAGCAGTTCCTATTGCATTGTACAAGTGAAACGAAGCGAGAGCAGGAGAGTCTGGAGGCAAGGGGG
ATTCAGTTGTCGAATCGAAAGGTGTGTACAATGTTGCAAAGAATAAACGATGCAACATACAGATAGATTTTCTTTGAAAAAAATGCAGCGCGGAGATAGA
AACTTACCCAAGATTGCCAACGCCGATATTTTATCGACATATGTCGATGTCGACGACTACGTTCCAAAAGAGGTGGGCGCTATAACTTTATGTTTTTACT
TGCTGCGGACTCAACAATGGGATGTACCATTCAAAGGAGCGACCAAGCACATCGATGAACACAACAACGCACCTCATTCCACCAGATCTCACTCGACGAC
CGCGAGACAGACGAAATGAATCTTCATGGACATCAAACCAGCATCGTGCGTGGCTCCGAGCAAACCGTGAAGATAAATTTCGCGCGATGCACATTGTTGC
TCTTATCGAGGAGGTGGAACGCGTGCTTTGTTCGTTCCGGTTTTACAAGGAAAGCGGATTGTTTTGTGCGACACCAGGATTTTCAGCGCCAATCGTCGAC
CCTGAAAGCGATCCAGACTTGTTCGTAAAGGGCCCCAAGCTCACCACGTTTCACGTGTCAACTCCGTCGGGCTCCCTCTATGAATACGTGCTAGACAACA
CAAATGACCTACTACCATTTGCCTCCGCTGAGGACCAACGTCTTGCACGAGAGATCCGCTTGCAAGAAGAAAAACGTGATACAACTGAGGTTTCTCGCTG
GCAACAACTGGATAACCCCCCCAAACTTGTCGAAGCAAGACCTGGTGGCTCTGGAAATACGAAACGCAAGTTAATGTTATCACTTGAAGTGGTGACTGTT
GATAATCCACAAACGATGAATCCGGTCTTTGTGGAGTATAAACTTGTACTACCTCACGGCATGGGTCATCTCGATTGGAAATTGCAACCTGGAAATTTCG
ACTGCAAACGGGGTAGGACGCCGCTATCGTTGCCTCAACAATCCCCATACACTGAATGTGGGTCTTCTTCGGCAGCGTTTGGATGGCTTGAACACTTCGA
CTTAAAACTCATCGATGTTGAGAAATCGCTTTTAGCAGCAGAAACTTCGTCCCAGGCAGCTAGAGATGCTGATTTCGGCAACATTATTCCCGCTCCAATC
CTTTATTTGAGCGTGTATTCACTGGATTGGTGGCGCCGAAAGCACACAGAGGGCCATGGGGAGATCGAATTGCAAGGATCCTCCGGATTTTACGACTTTG
ATGTGCCTATCCGGAAACCGATTACTTCCATTCGTGATCACATGGAGGAACTTTTTCTTGGCATCGGTGACAGTGACACCGACCAAGACTGGAATGCAGA
TCGATCCCATGACCGAGAAATCTGCACTGACGAATCTCCGATATCGACTATCATCACAAGCCGATTGGGGCAAAAGTCAGAGTCCACAGGCTCCACCGTA
CGAATTCGTTGGAGCATATTTGACCTGCGTCCAGCAACTCACGCAAACGGGATAGTAAAAGTAATGCCAGCAGCTTCTGTTGCGCCCTTGGCTAATACGA
AGGTTGTCAAGCGAAGCGTGCAGGAAATACTGCAATCAGTAAAACTGGAGAAGAGGTTGGCTAGTATACCAGATGTCCGTGTCCAGACGGCTCTGCGCTC
CGTGCCTGCCGGCGGAGTGGCAGCAACAGAATCACTAATAGACCAAAGTGCTCTAGTTTAATAGCGACGGCCGGGAACGACCTCAAAAGTGTATTGCGTA
GTTGAATCGGACAGACAAACACGCTTACTCATCGTCACTGTCCAGATCGTCCAGCGGATTGCCGCTGCGCTTCTTCATGACGCGGAAGAATTCCTCCTCG
TTAATGAGCCCGTCTCCATCGCGGTCGGCTTCGTCGATCATTTCTTGCATTTCTTCGTCCGTCAGCGATTCTCCTAGTTCGGCGCACACGCGCTTCAAGT
TGCGGAAGGAGATCTTGCCCGTGTTGTCGTCGTCGAAGAGCTGGAAAATCTTCATGATCTCCTCACGCGAGTCTCTCGAGTTCTGTCAGAGGACACCAAG
AAGACAGTAAACCTTAATACATCGAGCCGATTCTCCCCTCATAGTCATTGCAACGAACCATTTTCCCGGTCATCATCTCGATGAACTCGTCCTGGTTAAT
CGTTCCAGACTCGTCCTTGTCGATGTCTGCAATCATCTGCCGGATCTCTGCCTTCTTCACCTGGAACCCCAGTGCCCGCATTGCAGCCTTGAGCTCACGC
ACGTCGATAGAGCCACTGCCGTCCGTGTCGAAGAGATGGAACGCCTCCTTGATCTCTCAGGTCTTCTTCGTCCAGCACCTTCTTTACCGGCTTGGGCTTG
CGGCGCAGCGCAGCGCGAGACCGCGCAAAAGCCGACGCGGACATGGTATTCGACTACCACGAAGCACAACATCAGTCCGTCAAATGTACGTCGTCACGTC
AAGCATGACGCTAGACGAACGTACCATTTCTCCAGCGAGCAGAATGAAAGTGTCCGTTGCAAACCAATGGCGACCTTTCGGGTGCACACTTCAACGTGGA
GGTTCTACTTTAATGACCGAACCTCTTTCGTAAATTACAGAACCCGGTTTTCTATTCCGGTTCGTGGGTCAGACAACTTCCTTCCTGCCGTCACACTCTT
CAATTGACCAGCACGCACTCACTTCCTACGACCTTTCAGCGCGATGCTATCGGCAGCAGCGAAGCGTATGCGACAGAGCACCATGCACACGCTCAAGGCC
TACGACAAGAGCGAGCACCGGCTGCTCGTCGTGGGCGCAATGGCTTCGTGGGCAGCAACATCTTGCAGCGCGCCGTGCAAAAGGGCATCGAGGTGCGCAG
CCTTAACCCGTCGGGCAAGCCGCAGTGGCAGGACGTGCCGTGGATCGACCAGGTGGACTGGCACGAGGGCGACGTGTTCGATGAGAAGCAGCTGGCCAAG
GCCGTGGAGGGCGTCACGGGCGTCAGTACGTGCAGCTCTCCACAGACTCGACGTCTTTTGTATTGACGACGCATGGTTGCTGTTGTTGTTGTGTAGTCTC
CACTGTAGGCGCGTTCGGCAGCAACGAACTGATGGAGAAAATGTGTGGAGACGCGACGATTCTGGCGGCGAGAGCGGCGCAGAAAGCAGGCGCGGAGAGA
TTCGTGTTTGTGTCTAACTCGCGCGTGGGCTCGTATTTCCCGCCGTGGCTGCCGATGCATGGCTACTACAATGGAAAGGAGAGAGCCGAAGCTGCTGTGC
ACGCGAGGTGAGACGTGAACTGACGGCATCTATTGGGTTTATTCTGTTGCTGACAATTTTTCGTGCACTGTCAGATTCCCAAACACTGGTGTGTCGCTGC
GTCCGGGTTTCATCTATGGATGGCGCCGCACGAAGAAGGGTCAAGGGATTCCGCTGCAACTTGCGGGGCTCCTCTTTCGACGCTGGCACGCGACCTGGGC
GCAGTTTCAACAGCGCTGGGCTATGTGCCGTTCGTTGGTGAGGAAATGAAAGCTGCTATCCCTGTAGGTGCCGTTGCCAAGGCTGCAGTGCTCAGTGCGA
TCGGCCCTGTGCACGGACAAACGCTGGACACGACGAGCATGCTCGAGATCGCTGCCTCTTTCCACGTCCATGAATAAGAGTGCGATGAACTTATCCAGTC
GACGAGGGCAATGAAATCTGGAACTAAATCAATTCCAGCGACAATACCATAAGGCCAACCTCCTAACTCCAAAATTGACGGGTGAACTCAAGGAGGGTAT
GACAAAGCTTTCATTACCGCGTTTATCTTTTCGCCATCGCCTGAGCTGTGTACTTCATGCCTATGACACCGATTTTCTTTTTGCGATCTTCTGCTTCTTG
TCGTCGCTTTGCTAATTCCTCCGTCCGATCCTTCCAGTATTGCTGTGAAGATAAACGCAACCATTCCATAAGCCTCACGGATATCGCTGTTGCAGCTCAA
CAGTCATGGCGTACCTCTTTCTGCTTCTCCTTCTGTTTCCCCAGATTTTCGTTCAAACTCTTCGCGTCAGCTTCATTTTGCTCTGCTTGACCAGGTAGAC
AAAGCTCTTCCAGGGTCTGCACCCAGAGATCACGGACGCTTGTCGCTCCAGCTGTGAGCTCAAGCAGTTTCTGGCCATTCTGCCCGAGCAGTACTAGATC
GAGACGACCTATGCTCACAAACGGCCTTGTTAGCAACAACACGAACCAGCAGAAAATGGCTGTACGTGCCGTACCCATGGGACACACTTTGCCAATCTTG
TGAATCGGCAGTTCCTCCGAGTTACTTGGACCGGGCGTCTGGCGCCACACGAGCCTGCCGTTGATACAGATACTGGTTCAGTGCTCGCATATCATTCAAT
TTTGCCGTTCTAGCATCCTATTCAACCTCGTAGCTGACGGGTTCAGCTGTAAGTAGACACTTTCTGATCTGCTGAGCACCCCCAGAAAGGAACTCTTTTT
CTTGAAATCGTTGCCTTCTTTGAGCAGCTCCTGCCTCGCCAGCATCTCCGAGTCGCCACCACCGCAGCACACATTGCCCATGTCCTTTCCTCCTGTAGCA
GGGACTCAAATCAAAAATACAAGTCGACTAGAATAGGTTGACAAGCAGTGTGGAGTGCACGTGTATTTCTCAAAGCTTGTTGGAGAAATCAAGAATGAAA
TCGATACAGAACAGCTTTTCTCGCTGCTTGGCGCGGCCTAAGCGATGCTAGACAGAGAAAGTTGTCGGACAACATAGAGACGTGATGCTTATTTAGCGGC
GCAGAGACTTGGTAGCAGACTTGGCAGCGCAACCACCACCCGAAGTCGGGATAGTGCTCGAGCCCCATGGGGAACCCTTCGTGGCATCACCCGCACCACT
GGTAGAGCTCGCGGGGGTAGCAGAGGAGCCCCCGGTTGAGCCTGCTGCGCTCGAACTGGCATCGGAGGAGCTGGGAGCAGACCACCCAGTGCCCTTGGTG
GCATCCGATGCTCCCTTGGTAGCATCAGAGGCTCCAGTGGTTGAGCTCCCTGCACTCGAGCTAGCATTCGAAGACGCAGGCGAGCTGGCAGCAGTCGACC
CAGCGGCGGAAGTGGTGGAGCTAGACGCACCACCTTTCGAGGCGCACGTTGTGGCCTTGCCCGGAGTGGTCGTGAAAGCCGTCACCGTGAAATCGGGCTT
ACCGCCCTTCTTCCACGTGCAGCACGGGTCACCAAACGCTGCACCGTTAGTCATGCTCGAGCTCGGGAACTTGGCTTGGCACAGACTGCTGGACCACGTG
TGACCGGCAGCAGCAAACGCTTGAGCAAAATCCGTCGTCTTGGAGCTGTCGTCGCCAGGGTGACCGAGTGCCTGCTGGAAGGAGGTGCCGTTCGGAAGCT
CGTTGAGGTACTTGGCGAGACCCATAGCGGGATCCACCGTGGCGGCGATAGTCAGAGCAGCAGCGGCGATGGCAACTTGGATCTTCATCTTGGTATGGCG
TGTTCTGGTTCTGGCGGTGCGAGGTAAATTCAGGAGTGAGAAGTGAGAACTTACCCGTGTTGACTTTTCCGA