Description :
From Genome Similarity Track
Location :
Scaffold_571:18460- 21574
Transcript NameFunction/comments
g16148.t1hypothetical protein

Sequence
3114 bases(100 bases per row)
CGAAACGCCAACTTCCTTCGGGCCTCCAGCCCCGCCCTGCGCGGGCTCCTCAACATGATCCTCCGAGCTCTGCAGACCTTCCACAAGGTGTATCGTCGGC
TGCAGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCTCCTCGCTCCCCGACCTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGC
CCCCAGGGCGCCGTTGATCGTTTCGATCAAAAGCGTCCACGACGTCAGGGCAGTCTTGCCGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGGG
GTACCCTCGCTACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCACAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGC
AACGCCGGTGGCGGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCTTGAGGACGCTTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTC
CGTGAGACTCTCCATCAGGCCGAGAACGCCTATGATCGCTCATGGCATGAGATTGATCAGGTCCGGGAGCGCGTCGACTGATTCGAGGCCCCAGCTGCGC
TGGCGAACCGGGTCTCCGACCTTGAGCGAGGTCAGGCGAGGTTGGAGGGTCAAGTCGACCTTCTGCTGCGACTTCAGCAGGGTGCTGTGGCTGCGCCACC
TGTGCACGTCCCGGTGCCAGCGCCTCCGCGCTCACCCGCGCTGGGTCCCGGTACGGCTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCT
TCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCATGACTTTGAAAGGTCCGATGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGC
ATGTGTAGGTAGGTTTTTTGCGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTTCAATGTTACCTCTGCCCCTGGCATCTGCGTTTCCTTTTGTTGGT
CTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACGCGTTGACAGAAACTCGTCAACCTGTTTACGAACAGCGAGAGGGCTGACATC
AGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGGTAGCGTCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAACGGG
GTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAAATCCACGAGTGGAAGCATGGTGCTCCAACGCTTGGGCGTTTCGACGCAAACGCTGCGGA
GGACGTCCTCCACAACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATGATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGAC
GGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCGGGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCT
GTACCTTTACCATCAATGGTGTCCGGCACCGCCGCTAGATGAGCCATCTTGCTCAAAAGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCT
TCGGAAGGCCGAACACAAAGTCCAAACTCATGGACTCCCAACACCCAGAGGGTACAGGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCAC
CCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTGGGCCACCAATACGAGAGGCTCACAGAGCCATAGGTCTTTTCACGA
CCAAGGTGGCCACTAAGCGCAGTATCGTGTGCCTCATAGAGGATACGATATTTCAGATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGAT
CGGTGCTGTAATACAGCAGGCCACCATCAAGCGAATATCGATGCAGCCTCGCGCGTAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCT
CCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCGCGGATCAAGTCCGTCACGGACGACGTCACAGTCGTGGCATGAGATAAC
TCATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGTCAGC
GGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCT
GAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACG
CGTTCACGCCCTTCAGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGATGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACG
CCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGCTCGGTGTCCCAGGCCCACTCCGCATCCTTCTTGAGGAGATTGGA
CAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAGTAGTTGGCGAGGCCAAGCCACTTGCGTAGGTCCTTTTGGTTCTTGGGAACCGGC
CAGTCAACAATGGCTTTGACCTTAGCGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAAGGGGATCTCTTCGGCACCGAAGATGCAAT
TGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACG
ATTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGAAGGAAATAAACTTGAAAAAGAAAAAAAAAAAAAAAACAAACAAA
AAAAAAAAAAAAAAAAATGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCG
CTCGGGGTGCTGAC