Description :
From Genome Similarity Track
Location :
Scaffold_1695:1846- 3458
Sequence
1612 bases(100 bases per row)
GATAGAGACGACGGATCAGAACATGGAACAGGCGGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCT
ATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCT
GTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTACGCGGAAGTTATATTCC
GCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCGGTGTAGATCACAAAGGGCCTAG
AGCCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGTTCCGCACGGCGGCTTTGAGTTGCCT
GGACTGGAACGAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGC
TTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCCTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCCTGCTCCCAGCGCCAGTCGACGT
CCTTCTGAAGGAGGCTCGACAAAGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGATAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTT
CTGGGATCGGGGCGTCGGTCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTGATCTCT
GGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTTGCATCACGTCCAATACTCGACGGAGGTGTCCTAGATGCACCAAGCCCTGCG
GCATGACGAGACACTCCCAAAGCATGCCGCTTGGGGTACTTACCGCGGTGAGCGGGATGTCGCTCTCTTGCATCAGGATTTGGTAGTATCCGTCTACCAA
ATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAGCACGTCCTTCCGTGGGATTGGTGTTTGGGTCGGCACCGTTGCGTTGTTCAGCTTG
TTATACGCGTGAACCAGACGACACTTTCCGTTCGGTTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGATTCCCGCACCATGCCTGCCTTCG
CTTTCGCGGCGAAGAAGGCATTAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGTCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTC
GTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTATTCACCACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTC
TTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGG
TCTCAGGTCTCA