Description :
From Genome Similarity Track
Location :
Scaffold_72:184586- 186362
Sequence
1776 bases(100 bases per row)
GATATGTCTGGGGGTAACGCATCGAATAAATGATGTAACCTAATGGAGAATTTTCTAACGGAGAATGCTAAATAGATTAGTTTTCCGAATGCTGTACATA
TTCAAAAAAAATTGTAGCGGTGGAAAGGGCTCTTTTTAAAGCAGACGCTGAGAAAAGCGAGTCGATACGCCCACTCCTTAGATGACGAAGTTTGTCATCT
GGGGGAACAAGTCTTTAATAGTTGTTAGCTGCCAGCTAGGTGGCGACAATGAGCCTCATTTCGAAAACAAACACGACCAACAAACTCTTTTCAAACGCCC
CAAGTACTGTTGTCTTTTTAAAGACATTATTTTCGATCTTTTTTTTTCAGTACATTTCGTGGGCCTTCCAGTATTGAGTGATGTCCCTGCTCGGACTTTC
GAGTACATAGATTTCATTTGGACGCATTCGCTGTATCAACTTGCAACTACTGATACCACGTAAAGGTGTTGCTTGTTGGACTAGCCTTTTTAGACACAAA
TATTATGCTACAAGCCTTTCTTCTTTTGCTTCAGCTAATAGATAAAGCCAAATCGTATACGGTACACTATTCATTTGGAATACCGTTATATCCTACAGCA
TATTCTATTAAATACAGTATACTATTTTCCCAGTTGCATTGAGGTTAGCCTTATTTTTCAAGCATTTATCCCCCAACAAATTTTATCCTTAAAATAAGGA
CAGAAACAAATCCGGCGGTCTCAATTTTAGGGTGATTTTGATTTTAACTGGCCGGTTAAGGATAAAAATCATCCTAGCATTTGTATGCACACACTTATGT
ACGATCACAGAGGGCCTCGCGTTGGACGCGAAGAGTCGCCGACGGTTTCACTTGTTTCTACTATTGGCCAAGCTATTGTCCTTAACGTAAGGATAAACTC
GAAAAAGCGATACGGTCCGAGTGACCTTTTGGTCGAGCTGCTGCGCAAAAGTATCACAACTCTAGCGCAAACAGGTCCAGCCCTCATGTAGACCGAATAC
AGACCTTTTCTATCCATACCTGTCATAGCTTCTTACGTGTAAAGACGAAATCAAGGGGGTTGCCTCAAATTTGATCCTTGTTTTATCCTTAAAAGATCTT
GTTGGGGTTATGATTCGACTGTATTTGTCATTTTTTCAAAAGTACCAGTCTATTTAGTTTGTGTTTCTGAAAAAAATTCAAAGTGCAAGTTAGATGCTGC
TACAAAATAGCAATTCCTAACCACGGTTAAAATAATATTTCGATGAAAACTTAAATTAATATATAATATTAAATCAAATTATCATCACACTTTGTTGTTT
TTTCTGATGCTCTGTGTTATATTAATATACAAATAATCACGCCAGTTCCATATTTTTAAATATATTCTATTAAAATAGTATCCTCTAAATTGTGCCCCAC
CCTCAATTAGTACCCCACCTCTCATTTGTGATTACATTTGGTGGGGACTTACAAGAGTACCCCACTCTCTAATAGTAACCCACTCTCCACTAAAACTTTA
GTACAGTACCCCTCCCAATCTTAGTACTTGGCATTATTAGCAGCGTAAAGTTTCTTGTTGTCGGTCTAACCTAAGAAGGGTGTTGTATGCGTTGTCTGTT
GGGTTGCGATTATCTCGAAAACTCTAAATGGTTTGAAACCGTCTCATTTGGACTAGGTATTAATACATGTAATATGCAGAAACGACTGTAAAACTGCAGA
ATCACGGTAACTTGTCCCCTTTGTCCGACAGCGTTGTGACCGCCGTTTAGTGAGACTTCCATAGCGCTGTGTTTAG