Description :
From Genome Similarity Track
Location :
Scaffold_65:184545- 186174
Transcript NameFunction/comments
Physo_138625predicted protein

Sequence
1629 bases(100 bases per row)
TTGAACGTCGATCGGTCTCGACAAGAAAAGAAAAATCGTGCGCGCTGCATAAACCACGAAAACTGAAGTTGAATCAGCAATCTGCCTCCGGTCGGCGTAA
GCGGAGGGACACCCAGACATTTTGATGCGGTTCATGGGCCCCCTTGCGCTGCGTCTCACAGAGACTCTCCAAATCCCTGCAGTCTGGCCGTTAAATGGGC
AGAGCATTCATCGCGCGGTATGTATCGCAGATGGCAAGCGCTGAACAAGGCTTGTTGGCGTGCTTGTTGAACAAGCACACCAACTTGAGCTTCAGAGAGC
CACCGCCTTCGGCCCAAAGACGACGTGGCCCTCGCCAACAATACGGCGACGGACGTTAGCCCCGAGCTCAAAGATCGTTGAGTCCCTCATTCCCAAATCG
ACGTTCAAGAGCTCAAGTAGCTGAACACCACAACCCTCCCCCACTCCAGCACCATGGCCGCTACCGACCTCATCATGTCCGGCGACTGCGGCGGCACCAA
CACGCGTCTGTCGCTGTGGAACATCCCCAAGGAGGCCAAGCACATCAAGGGCGACATCGCCCCCGGCCAAATGGTCTTCTCCAAGAAGTACCTGAACGAG
GAGTACGCGAGCTTTGCCGAGGTGTGCCACCTCTTCCTGAACGAGGCCAAGCTCGTGAACGAGGTGCCTGCGGCCTGCGTTCTTGCGTGCGCTGGCCCCA
TTCTTAAGAACACGGTGGACTTCACCAACGTCGAGTTCGGCTGGAAGATCGACGGCCCGGGTCTGGAGAAGGAGCTCGGCATCAAGAAGGTCCGTTTGAT
CAACGACTTCGCCGGTATGGGCTACGGCCTGCTCACCCTGCGCCCGCACGAGTACATTGTGCTGAACGACGCCCCCAAGGACGAGACCGCTCCCATGGCC
ACTATCGGCGCCGGCACTGGACTCGGCGAGTGTTTCTTGACCCCTGGTACCGATGGCCAGTACTCGTGCTTCGCCTGCGAGGGCGGCCACACCGACTTCG
CCCCCGCCGACGAGATCGAGATCGAGTTGTACAACGAAATCAAGGAGAAGCTCGGCTGCGGCCAGCGTTTCTCCGTGGAGCGTATTATTTCGGGCCCCGG
CCTGGCCACCATCTACGAGTTCCTGGCCAAGAAGTTCCCCGAGAAGGTGGACCCCAAGGTGCACGAGGAGTTCCTCAAGGCCAACACGCAGCAGGGCAAG
GTGATCGGCGAGAACGCCAAGACGAACGAGCTGTGCAACCAGACGCTGGAGATCTTCGTGGGCGCGTACGGCCGCGAGGCTGGCAACGCGATGCTGAAGT
ACCTGCCGCGCGGTGGTTTCTACATCACGGGCGGCCTGGCACCGAAGAACCTGGACTACTTCACGAAGAAGGACATTTTCCTGAACTCGATGTTCGACAA
GGGCCGTGTGAGTCCCGCCATCCGTGCTTGCCCGGTGTACCTTGTTTTGAACGAGGACTTGGGCGAGCGTGGCGCACACTTCTACGCGTATCAGCTGCTT
CACCAGTAACACGGCAACGTTGATGCCTCGTTGGTCCCGGTGCTGTCATCGTAGGCAAGCTGGCCACCGAGGCTGAGGTGTCTTCAGTTGTAGCGAGGCA
GGGTGATAGTTAAATGTTGATAATAACTT