Description :
From Genome Similarity Track
Location :
Scaffold_11:1845350- 1848007
Transcript NameFunction/comments
Phyin_T30-4PITG_07561Transmembrane protein%2C putative

Sequence
2657 bases(100 bases per row)
CCTGTGGTACGCGCCATCCGGGTACCGCTCACGAAGATTTAGATATTTACCAGTAGGGCGCCCCGCCCCTACTGGTCTCCGGCGTTCCCCTGGTCCCGGG
TTCTTGGCTTCTGCCGGAGACCCTTGAGGATGGGCTTGGGGAAAGTCCGCCTGCGGGGTCTTTCCGCGGGGACGTCGTGCTTAAAGTGGTCCAGCTTCCC
GCAGACAAAACAGATCGCGCTGTTTGGCGGACCCAATCTCCATGGGAACTGGTCAAGTGGGGTTCGTCCGGCCGGGATTTGACACCGAACGCTCTGGTCA
CGCTGAGGCCGGCTACGCACCTGGCGATGGCTGTATTCTTCGCGAAGATCCACTTGAAGTGTCTCTTCGAGAGTGCTCGGCAGCACTCGGAACAGCTGAG
TTCGCGCCGGGCTCACTCGAAATCCGTCCATGAACACCGTCACCTTGATGTGTTTATTAAGTGGGTTGCCCACTAGGGACGCCGTGAGCTCCCCCATCTC
TTGGATGTACTTGTGCAGCTCACGCCTTCCTTGTTTGCTTGAAAGGGGGCGTGGTCGTTGACAGTACTCGTTGTTAACCGGGAGAAACGCGGCTCGAAGC
TGCTCGACCAGCTGAGCCCAGGATGTGAAACATCCAGGCGATGTCACCTCCCGCGTGTACACCAAACTCTTGCCACGACCGCTAAGGTTGGAGAGCACAA
AAGAAACGCGGAGTTGATCGGTCGAGTCCACCACGAGCTCTACCTCTCGAACCCAGAATGAGAGTTCTCACCTTCTTTCCTTTCGCACGGCTTCACCTTA
AGCCGTATTCGCTTCTGGTGTGGCGGACTTGCTTTCGCCGCCGGAGTCTGCAGGTTTCCCCGCACATGTGCGATGAACCACGGCGATACAGCGAATGCCC
GTGCGATTTCGAGACGTCACCGATTTCGCGTATAGATGGTGTGAAATGCATAGCCGAACAGGCAAATCAACAGATCTCCCCACCGGCTTGGTGCTGTTTT
GATGGTGTGGGACGTACCGCCTCGCGCTTTATCTTCACGAAAAAGGCTTCTCGACTCAAAGTGCAGATCACCAGTCTGTCTTTCAGTGGTTTCCACTTGT
ACGTTGATTAATCTCTGAGACCGTCAGCAAGTTTCATTCCGAAATTCGCATTCGTTCTCACCAACAGCTTCCAAAAGTACAGGCCCATGGCGTCGCCAGC
AGGACCCCCCATTCGGATACCGGTATCGTTTGTAAGCGGCACTCCGTCGCAAGCCAAGGACCCTGATAGAACTCCCAGCTACGCTCAGGTCAAGACCCCG
GATCCGTCGTCCCTCGAGGGTGGCGCTCTACGTGAAGGTGGGACTTCCGTTCTTACCAGCAGCGACAGTATCGGTTTGCTCTTCCAATACGCTGTGGTGG
GTATCAACTACGGTCTGCTGCCTGCCACGGTCTACCCATTCCTCCAGCAATACCTGAATGCTACCGGTTCTCAAGTTACCACAGCTGCGACGCTAGTCAT
TCTACCATGGAGTTTAAAGGTGTTCTACGGTATTCTATCCGACTGTGTGCCGCTTTGGGGATACCGACGCAAAGTCTGGATGCTTATTGGTTGGGCCATG
TGTCTTACGATGCTGATCGTCATGGCCGCGTCTCCGGCCGGTCAGCCGTACTACACGGTCCCGTCCGACCGCAAGATTGATCCCGCCGATTACACACCAG
AAATCGAGGCTCGCATTAACTTCGATGCCGGTAATCAGGCTGGCAAATATGTCATGCTCATGTTCTTCGCTGCTATCGGATACGTTCTAGCTGACGTCTG
CGCCGACAGTATCGTGGTGGAATACGCGCAGCGTGAGCCGGTCGAGAAACGCGGTAAGATCCAGTCGGCTATCTACACAATCCGCACTGTCTTCGTCATC
ATTGGACAACTCTTGGTGGGCTTCTGCTTCAATGGACGGCGGCCAGTTCGACTTCTCGTTGAACTTCCCCGAATTAATGTCGATCGTCGCGTGTATCACG
GCGCCGATCATCCCTATCACGTGGCTGTTCATTAAGGAGGAGAAGCAGACGCGTGTGCCGTTCAGGAAACACATGAGCGAGCTGTGGGAACTCATTCAGA
AGCGCGCCGTCTACCAGGTCATTTTCTACCAGTTCTTCCAGAACGTCTTCTCCAGTATTACGTACACTGCCAGTTCCCCCGTCCAGTCGTACATGGTTGG
TGTCACTCCGATCAACAATACGATCAGTGAGATCATCAGTAATGTTTTATTCATGGGTGGTATCATGGCGACGTCCAAGTGGGGGCTGCACTGGAACTGG
CGCAAGATGATTCTCTTTACGGGCATTTTCGTCACCATTGCGGACGGTATTACTACTTTTCTTACTATTTGGAGCGTGCTCCGAAGTCAGTGGTTCTGGC
TTGGTATCCCCATGGCAGTGCAACTTCCATACGGTGTCGGCTGGATGATTGGTTTCTTTGTAATCGTCGAGCTGTCCGGCGTCGGTAATAAGGGGGCTAT
TATCACTATGGTTGGCAACTTGGCGTCTCCATTCGCACAGGCCTTGACGCTCGTAATTAACCAGCCTCTTAACTTAACGACAGCTCGTATCCAAGCTGAC
GATAACTCGATCCGAACGGACCTCACGTACGCGGTGCTGATCATGTATGGCATGACG