Description :
From Genome Similarity Track
Location :
Scaffold_38:184526- 185809
Transcript NameFunction/comments
Physo_135418hypothetical protein

Sequence
1283 bases(100 bases per row)
TGGCCTGCTTGCCGTTCTGCTGCAGGCACGGTGCGCACCACTCCAACGTGCCTTCGGTACGTCGTCTCTTCCTTCCCGTTGCACGATACGCCTTCTTCAT
CTTCTTTTTCGTGGATCCATGCTCCGCTTGATGGTGCAGCACACAGCGTCGATGCAGCTTGGCGTCATGGCACTTCGGACAGCTGTCCCTTTCCTCCGTA
GCGATCTGCACCTGTCGGCAGGTCGTGCACACCTCCACAGCAGTAGAGAACACGCTCCACCCATGGCCATCACTCTCGTCCATCTCTTCATCGTCAATTT
CCTCCTTCTCCACTGAAATTCCACTGTGCTTCGTGAAATTCCCGTCGTTGCGGGCCTTCCAGGGCCGCCTCACGTACGGGAAAGCCAGCGCCGGCACGAG
AATCGGCAGCGCTTCCTCGTCGAATGTCTCGTCCCCACAGTCCGTCTGTTTCTTGGCCTCAAAGCGGCATTTCGCGCACGTAAAAGCCGCTCCGATCGCT
GCTAGCCCTTGTTCCAGACCCCCCTCGAGCTTCGACAGGCACGGCGTGTGGTAAATACCGTCACAAACGCAGCAGCGGGATACCTGAGCGTCTTCTGTCG
TCGTGGACGGTGCCTGGGCGTGTTTTCCCGCCGAAATCGCGCCGCTGGGGGCGCCAAACGACGAATTTTCTGGGTCACGGAGGGGCTCCGCATCAGTCGC
AGTCCGGGCTCTTTTGTGGGCGGGATCGCGCGCTTTCGCCGCGAGGACGCCGCCCACTACCTGCTCGCACACAAGACACGCGAAATGCATGGTCGGCGGG
TCTCCGAGGAGCCCTGGGAGACGCAGAATCGACCGCGCAAGACGCCGCCTCCTTCACGCGCCTTCCGCACTCGGAGCCAAGAGCTTTTTGGAGGCGGCAA
CGCCCGCGCGGAATTGTGTGGTGCACGTCAAGTTGATGCGGAAAGTTTGTGGGTGGACCGGCTTCAAGTTGAAGTCTTCCGCATGTCCGGCCAGTGCATC
CTGCAGTGGGCAGCACCGGCAAGCACGCCGAGTATTATCGACCTGCTCAGTCTGCACCTCTCGAACATAAGCCCGTCGCTATCTCTGTTAGAGCCCCAAA
GCCTGGTTAATCGACTTTGTCCACTTTTTGTCGTTTGATATTTGCCGCTAACTCGGCCCTCTCAAGTCCCCGACTCAAACCTCTTTGATAGTCTCTGGTC
ACTGGCGAGTCGACAGTCGGGCAGGGACCTGCATTGTCGGACACCAATATGTCCGAGCCAGGCTACAAGAGTCGGGCAATTAC