Description :
From Genome Similarity Track
Location :
Scaffold_431:1845- 3830
Sequence
1985 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGAC
CAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTTCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCA
ATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCAGATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGG
ACCTCTCGAGTGCTGCAACTACTGGACCCCAGCAGTCGCAAGGAAACAATGTGCGATGCTACCGATGCGGTAGAATCGGTCACTTTGCTCGGGAGTGCAC
GGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGCGGCGCCCTACTG
GTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGA
CCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCGCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACATTGTTCGACTGCGAAGTGTA
TCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATCGTACGCG
TGCGCTTCACGTATTAGGATCAAGTGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACG
ACATAATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGATATCGGAACAGAGAGCGATGGCCCTGTTGCCGCTATGCACGCACCG
ACAGGTGCGCGCGACTCTCCAGTCAAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGTGCGAGCACGCGCGCAAG