Description :
From Genome Similarity Track
Location :
Scaffold_736:1845- 3421
Transcript NameFunction/comments
g16466.t1hypothetical protein
g16467.t1OWZ00441.1 reverse transcriptase, partial [Phytophthora megakarya

Sequence
1576 bases(100 bases per row)
CCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAACAGCGTCGATCTCGCGCTGGTCCCCGGTGGCA
GACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTCCCTTCATTTTCCGCGCCAAAACGAA
CGGTGCTTTTGGTACCCCGGTTTCGGAGCCACGCGGGCGCCTCCTGACTTAATCAACGCCCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAAT
ATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCCATCGTCGATTCTGAGTGAAGTAACCCTCTCCAAGG
TCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCAC
AAATCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTT
CCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAGTCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGAC
CCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACTCGTCCGTAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCC
ACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGGCCTCATCGAAATCCAGGCGATCGCTCTCGGCCACAAGCAACGGCG
CGTCAGGACGATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGC
GTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCTTCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACC
TGAGCGCCCACCGCGATGTTGTGGGGTCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCACGAACCTGTTCCCGCG
CTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCACGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCG
CGGGTCCCACCCATGGGCCAAGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGACCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAG
TCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTTAGAGTCTGCACCATTCGTTCGGCAGTTCTGT