Description :
From Genome Similarity Track
Location :
Scaffold_57:18448- 24419
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014037Protein of unknown function
Pytul_DAOMBR144PYU1_G014036Similar to Caricain (Carica papaya)

Sequence
5971 bases(100 bases per row)
GGCGTACATCCGCTTTTCGTCCACTGAAATGACTTGTAAGCACCTGTTCAGTAGCGACACGTACTGGTTCATGCCGTGCTCACCATGGAAAGCGCCCCAA
AATGGCAGCTCTTCTGGTACTTCTGACTTGATAAAGAAATTAGGAGAAACCACCGGTCCGAGTAAATGAACGTTCGGAACGACATAGTAAGTCATCCCTT
CTCTTTCCCGCTTCGTTGCCACGCACTTCACCAGCATGATATTTTCCTCGTCATCCGCTTCAGTGATACTATTCCGCATAGCCTGCGAGTCAGTCATTGC
TTGCTGCATCCCCTCATACCACATATTTCGAGTGGCATCTGTTCTGGTCACAAATGTGAGAGTCTTGTCCACTTCCCGACTTCGATCAAATGCTTCAACT
TGAAAGCCGAATGCCCCGGTACCTGGGTTTTTCACGCTTCTACCGAATGCAATCCATTTCCGGGAGTTACAGACGACGTATTTCTTCCGTCGTGACGTCC
AATGTTGAGTTTTTGCCATCAAATAGTCCTTCAGTTTTGTTGTAGACTTTCCCTTCACTGGGGATGAGCTGGAGCCAGCAGAAGACCGAGCAGGCACCGG
TACGTCCTCTAAAATCAGCAAGCAGCTACTCTTCTCGAATTTGAGATGAACTTTCACCCATTTTGATCGTTTCTGATACACGTATCCAGAAATACTGTCT
TCGTCTTCGACCAAGTCGAAAGACGTTCCAGTGTCTCCCTTCAGGACATCAATAATCGATTGCGGGTACTGACTCTGTGTGCGACTCCGGAACATGTCGG
TCGGGTTGATGATTTCGTTTCCTGTTGCAAGATTTTGCGGCGAACCAAAGCCTTCTTTCTCCATTGGTAAACGTCGAAATGGCTCGAGCTCTTGCGATAG
AAAGCCGGTCGCAGAGGAAGTGCGACGCGCAAGTGGAAACACGTCATCAACTCCATCACTTCCTCGTCTTCCATTCGCATTGTTCAGTCCACTGCCGTTG
AGCGAGCTAAGTCCCAGTACTGAATCATCTAGCGCATCAATTTGCTGATAATGAGACGATACCAGTGACGAACTGAATTCAGCCCATCCGGCAACCTTGT
GGCAATACTGTCGAATCAGCTCTTGCTCCAGACGTGGCGAGCTGCATATTTTGTCGATCTTGACGCCGATAATCGCGAGATGAGCATCGTAGGGATGAGT
GGCAGAACTTTTGTGCAACTTGTGCATGATAAATGCTAAAAGTGAATCTGGGGGTCGAAATACACTCCGCAGGAGTGGATTGTTCACTCTTCCATTTGAC
GACACGCGATCAAATAAATTCAGGTACAACTTGACGATTCGACAGTGCAGGATGTTTGCTTTCGGGAACTTTTCAAAAATGTCAATCAATGACGTCGACA
AGTCACACTTTGTTAGCTGTGCGTCCAAAGATTCTTTACCCATTCGAACAACTGCATCCAAGAAATCAATCACGTGTATCACGAGCAAAATTGATGCAAG
CGGCCGATGGTTGATTAAATTCTTTCCGGAGGACGGCGAGAAACACGTAGCAGGAGGTGGGATGCTGCTTTGGTGTAGATGCCTTTGCATCGTCGCGGGT
GCAACTGGAGGACTTGTAATAGGAAGAACTTGCGACAGTAACACAGACTGGTTTTGCAATTCATCACTTTTGGAGTCATCGCCATTTGTATCCTCGTCTT
CGTCCATCGAGTCTTCCGAATCACTGTCGCTGAAGCAGTCTCGTGACGCAAACTCGGAGATCGTAGAAAAGTGCTGGTGATAGTTGATAGCAGCACAGAG
ATTCTCAGCGAGTAGCTGCACTGGCGGCACGAACAACTTCAGTCGGTCTTTATCTGACAACGAGTTCTCGATGCCAAATCTCAGAACGTCGATGACCAAG
GTAGGAGGAATTCCAGCACCATCGGCGTGGTTTGCGTCCAAATACCGTATTTCTGCTATTGCAACTTCAGCTAATCGAATGAGAATGTTTGGCCTCTCAA
GGATAGCCGACATCACCCCATTCTTGATTTGTTCATGCAGAACGCGATCATTTGGTAAGATTTTCGGAGGAAAGATCTCGCGTTCGAAAGCTTCCACACT
TTCGTACGATGCCAGCTGGAGCTTTGTCTGGATGTAATAGCTGAACGTGTTTGGAAACTCTTGTGACAGCACTTTCGCTAGAACATCAGCACATCCACTG
ATTCGAGCGTGGGTCAACGGACTTCGTAGATTGAACTGGGAACGCGCCGATGACGGACTTGAAGGCATATAACCCGAATCAATTGGTTTCTCGATGATTC
GCTCGACAAGACTCTTGATGATCGGCTGGAACCCGTAACTTCGTCGTTGGGCGAGATGAAGGAGGCCATGCAGCAGCGTTGACACCTCCGGATTGTATGC
ATAGTTGGCGAATCGCGCAAAAAGGGTTTCTTTTCCTTGCACTTCGATTGTCGATAAAATCTCATGCACCGCTGGATATGTCACGAAATTCTTCGTGATT
CGGCACATGTTTGCAAACAGGACACTGTCAATCTCGACCTCTGTATCGCTATCAGCAGTCCCCGCTTTACTCATACTAGCATTTACTGCAATTTCCTTCT
CCGAGCTCGACTTTGACCACATAAACTGATACAAACCGGAGAAAATGCGCTTCCATTCCGTACCTGTAAGATCTTCCAGATGCAGGATGTATCCTCTGAC
AGCGGCGCTCGGTTCACTCACATCAGAAAAGCTGCTGCTACTCCCTCTTCGAAAGCTTCGTGTTGAAAATGCGGATGGGCGAAAGCCTGTAGAGAAGCTC
AGCAAGAATGGCTTAGGCGGCAGCGGCAGCGAGGGCGATTTCTTGTTTGGACTTTGCGAATTAGGCGAGCCAGTCTGTGGGGAATGCGACGCGTCTCCGA
CTGGCTGCTCCTCCGAGCGCTGATTCTCCATCACAGTCGCTGGAGCAGCGAACGACAACGCTTTAGGCGAGCCGTGCCATGTCAGAGCCTTCAGGTAGAA
TCGCAGGATAATCTCTGTCGCGATGTACGGGCGTCGGTACTTTTCCGGGTCCGAGATGTGATCGTTCGGCGCAGGCATTTTTTGCTCGAGCATAATCGGC
AGCCTATTATGGCTCGCCTTGTGGTGACTGCTTTTTTCGGGGAACGTCGTCGCGTACATAAACACCTGCGCAATGTTTTCGGTCTCGAGCAGCATCATCT
GCATGGGGGACATCGCGCGTTCGCGCTTCTGCACAAGCGACAGCACCGTCTCGGTCTCATAGCACGCGCAAAACACGTTCTGCAGCGTCTGCGCCTGGCG
CAGTGCCTCTGAGTTGTGCAGCGCATGCGATGTCTGGATCGGATCGCGCACGCCAGACGTGTTGCGCGGGAGCCGCCCATTAAACGGCGGCGTACTCGTA
CTCATCGACGCTAACACCGGCGGCTGCCCACTCGCGGACGCTGATATAGATGCGCCAGTCGCGGCTGCTGCGTCACTCCTAGCGAACGCGGGCGAGATGG
GCTCCTCCTGGTCACCAAGCGGCACCTGCGGCTGGTCGCTGTCACTGTCGGCGTCCGAGTCCGACTCGGTCTCCACGGCGCACGTGCACTTGCGTGGCGC
CCACATGCCGCCTTTTGAGTAGAGTGGCAACTAATAAGAGACGCAGGGCACACACGCACGCACACACACACACAAACAGGATGCAGGGGCGGACCAACTG
GTAGTCGACGCGCGCACTTTTCTATTGGGCTGTGTCGGAAGGAATGCGGAAACGCGCTCCTCAACGTGGGTGAAACCCGTCGACTTAAGGCGCGGTTTTC
ACCATCATACAAGCACGTGCTGACGTGTGATACTTACTGACAATAGTAATACAGTAAGTTGCTGTATTAGTATTGCTTGAGTCCTGTCCTTTCTTTTTTG
GTTTGTTTTTGCTGGGAAATGATGGTAGGAAGTAGTATTAAGTCGACACGCTGAGTTTTTCTAAAGTCGACAGAGTTGAAGCGACTAGCTGTTCAAATGA
GCAGTTTCACACTGAGGCACAAGGATTTATTTTCAAAGGTGTGCTGTATGTCTGGGATATGCCATAAAGTATGCGATGGGTTCACATTCTAGATACCATC
AACAAATTAAACTGTAGATGTGATAGAGACATAGAGGTAATATCCATTTTTGCTGAACAGGCGCACGAATGACGCGAGCAACGGCCCCGGCTATGCAGTT
CGGTATGAAGCAGTGAATATGCGCGCAAGCAAAATATTATGGCAATAGTGAAAACCTCCTTGTTGCTTTGCGTATTGTTCCGTTTTGCAGATGCGTATTC
CACAATTCAAAATGCAGCATTCGATTCTCCGAATCTCTGAAGTCGCAAGAGTTCAGCACCAACTGTTCTGACTCGATTTGTTACTGTTTTTCAAACGGAC
ACTACCTGTCGACACCTACGTTTACGACCTCTGATATGCATGCTCCCAGCCTATTTAAGCCTCATACAAAATTGACACGACGCGCTATTAGAATGTCGGG
TGCGACATATCGGTGTACATGGAGCAGGTGCCCGCGCCGGCGCCGCCGCGGCGCATGCGGATGTACCCGTTCTCGCCCCAGCGCGTGCCCCACGAGTTCT
TGATCTTGATGCTAGACGCGTCGTAGCCCACGGCCAGCACGGCGTGGTCCACCTGGCTCGTCTGGCACGACGACAGCACGCCACCGACGTACTGCTTCCA
CGCGTTGTTGCCCGCGGCGACGGCGATGACGACGGGGTGCGTCGCCAGCGTGCTCACGAGTCCGGCTTCCCCTGAAACACGCGCCGAGCCCTTGATGCCG
GTCTGGGTCTTGGCGCACGACGACAAGCACGCCGCGTTGCCTCCGTTGCTCGACGCGTATGGGTACGCTTGCTCCGTGCACAACCCGTTCTGCTGGATGT
ACTGGAACGCGTACGTCGGAGCGCCGCCATTGCAGCCCAAGTTACGCTTATCACAGCTCGTGAGCTGCTGCTCCGAGTACTTGGTCATCGTCTTCTTGTC
TCCAGCGAGACATTGCGCGGCCTCGACCGCGGCGACGGACGCGAACGCCCAGCACGAGCCGCATTGGCCCTGGTTCTGAGGCGGCGCGACACAGGGAGAC
GTCGACCAATCGAGCGAGTCACCGTCGGCAGCGACCGGTGTCGCAGCTCCCGACGAAGGGCCAGTCGCTGGGTTTTCTGGAGCCACGACCGGATCCACTG
GCGCGACCGGACCACGAGACGGCGAGGCTGTCGTTGCAGCAGGCGCGCGAGTTTTCACTGGCGCCTGCGTAGCCGGAGTTCTGGTTTTTGGAGCAGTGGT
AGATGGAGTGTCAGTTGGAGCCACGACCGGCGCGCGCGTTGGAGCTTTGGTGGCCGGCACCGGAGTTGGGCGCCAAGTAAAGAAGCTCGAGAAGTCAAAT
TCGTATCCGACGTTGTTACTCGATCTGGAGCCACTCTTAGAAGGTGCCGGTGCCTTGCCATTTGATGGGCGGTTGATCACCACGGTGCGGCTGTTGCTGT
TGCTGCGCTCACTGTACGTTGGCGCTTGCATCGATGCCGAGTTCTCATCCCACCAGGAGTTGTCTTGACTATGGCGAAGACGACGGCGCTCTTCGTCTCC
ACGGCGGTAGGCGTTACCGACGTACGCGTTGAATTCTTCTTCAGTCATGAGCGTGAACGGCGAGTTCGTGGAGAACTGCGCGTTTGGGTTTTGCTCTTGG
AGTTTCTTGATGTTCTCCTTGGTCATGAAGAACCGCTGGCGCTGGTCTTCTTCGGTGTCATCGGCCGAGCGTGCTTCGCTCACTGGGATCCACCCGTTCT
CCTCGGCCTGGTCCTTGAATTCGTTCAGCCAGTCGTCCAGTTCGGCCTGGATGCTGTCCTTTTCCTGCAAGTATCGGTGATAGTGCGGCTCAATCGCGGC
ATGCATGGGGTGTGCTTCCAGTGTCGCCAAGCTGCTCGCAAGCGCGATGAAGACGGAAGCGCAGACCAAGG