Description :
From Genome Similarity Track
Location :
Scaffold_11:1843032- 1844310
Sequence
1278 bases(100 bases per row)
AGTACCCCCCCCCCTTTGACTTCTTGTCTGCTTGGAGCTTGTTCTTCCAAAAGTGAAGTGAGGAAATGCCGCGTGTGGTTGGCAGCAAGCAAGGAGGAGA
ACATATCAGTATGAAGTCGGTATACTGGTTTTGATAATTTGATGGGGAAGCACAAAATTTCTTTGTTTCGCCTTGCTTCACTATTGAATACACCTTATAG
GCCCCCATATCCCTACCTACTTTTATTTTTGCATACCAGACAGATATGGTGAGGGTTCCTGTCACACGTATAGAAAAATGAGTATGGCGTTGCACTAAGT
ACAGACACACGGGAGTAAATTTCCGGGCAAAGTGCCACTGCAGATCTTTGACAATTGGACTTTAATGCGTACCACTCCAAGCGGGAGTACAGCAAATGGG
TCATGATCACAATATAGACGGCAAATGCACCTGCTCACTTGGGTACCATATAAGCTATACTATTTGTACTGTCGACGCTCATACAGTCTATTCATATAAG
CTTGTTAATAAAGACAACTGTGTTTGAGCGAGCACTTATCCGAAATTATGCGTGACAAAAGACTGACATTCTACATAGATATGGGCGCGCGTGTCGTAGT
GCAGCACTTACAGATGGGCGTGTAAAATCGATGTGTCTGTGTGCACTATCAAACCTACATTTTTCCGCCTGGAATGGGCGAAATAAGAGCGCGGTCGAGT
CATAGGTGGCAATAAGGAATATCCGTCGTGCGTGGATCTATCGCGTTGGCTACTGCTGACAAATGCACGGTCAGCTTCCCTATGAGTGTGACCCAGGCCC
AGTTAGCGACATGCTTGGCTATGTTGAATTGTACGTATGCAGCGTCCGCGTACTAAGCTAGCACGACAAGACAAACAATATGCGGAAGTGATTTAATACA
AAGGCTATTGCTTTTCACGAGCGCGTGGCGTATACGCTCAATGACATTTATTTCAAGATGGGCTATACGTGGACACTTCTAGTGAAGCCATTTGGTTTTT
GTGGCGACCGTTGGCAATTAGATGCGGTCCTTATTTATACTACATACGCAAAGCTAATAAAACGTTGCTCAAACAAACTGTCGCAATCGAGAATACGATA
GCGACTGCCTCATTGCGAGACGAAGAAGTATCGATTTACTCAAGGGCGTAGTGGATGTCAACATGTTTAAGAAGGTGAATTTGCTCTGTATTTTCTTAAA
TGAGATTTCCTCACCGAGGTATGTTGCGTTAAGCACCAATGATATTGACCCGCCTTCTGAGCGGCAGAGAGTTACATT