Description :
From Genome Similarity Track
Location :
Scaffold_1012:1843- 7296
Transcript NameFunction/comments
Physo_145317reverse transcriptase

Sequence
5453 bases(100 bases per row)
TTCGGGTGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTGTGCAGCGCATGATGGGCTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCA
AGACGTTCCGCAGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATATGAAAACGAACTGGTTGCCTGTTCGTTCTCGGGATACTGTGATC
AACAATCCGCTCAACAATCCATCGAGTTGAGCCGTGTGCATCACGAATCGTGCGGCGGCGGCGGCGGAAACACACCCCGTGCGTGGTCAACTTGGTGTTG
ACCCTGATCTCGTGTCTCCCCACGACCAAGTCCCGGTCGTGGAGTAGTTCCAGAGCGCTGCGTTCGGCGCTGTGAAGTATTCGCAGTTTGCGGCGGCCTC
CCAGACCGCCTCGATGGTTCCGACCGAGCTGGACCATTAGTTCGACCCGCTGCTCCAGCGCGAAGTCGCGCTAGAGAGGATGATGGCTTCCGCCGAGTCT
TCTGCTTCGGTTCAGCCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAATGTTGGATGGAGACGCATGCTAGACGGAATGTC
TAGCGTGTAACCATTGCCATGCCGTGCCAATACTGTGAATGGCCCGATGACGCGCGGAGCGACCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGC
AGGTTTCGCGTAGCTAACAAAACCAACGAACCCTTCTTGAATTCATTTGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAG
CTGCGATAGCGTCCTGGACAAACCGAATGACGGCTTGTCTGCGCTGTACGAAGTGAATTGCGTCCGAGCTGAACTCGTTCAGCTCGCTTCCAGCAGTAGG
CCCTGCCTCTGCGTTGGTCTTCGTGGAGTCTGTGCCCTGCACAGACACGCTCATCTTCTTCTTGTTGGTGTCTGTGCCACGTTCTTCGTGCGCTTGTCGG
CGCCTGCGCCCTGTACAGACGCGCAGTTCTTGGCTTTACTTCGTGTCGTTGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGGTGC
AGACGGAGATCCTCCCCCACTTATGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATGGCATTCACGTAGAAGGGTGTATGCCCG
GTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGGAGTAGGAACGAGTAGGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGT
CTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGCGCAGTGAAGCGCGGGTCT
CGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTAAACACCATGTCGACGAACAGACCTGCAGTCCGCTTCGCAGTCACTTCAGCGGGTACCGCAG
CAAGATGTACCATCTTGCTGAAGCGGTCACCAAAGACCACAACGCCCGTGTTCCCCTGACTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGA
CTGCCAACACTCTCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTG
CGCATCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGGGATACT
CGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCG
GTAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTACTGACAAGCTTTTCAGAAGGCGCTAAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGT
GCGCGTATGCGACCTTCGCGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTC
CGGTCGACGCGAGAGCGCGTCAGCCACAACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATC
CGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGGTCTGTGTAGACCACGAACGGTTTGCTTCTGAGTAGATACCCTCGGAACTTCG
CGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGGCGCGATTGGTAGTAGACGACACGATCACG
ACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAGTCGGATGCGTCACACACAATGTGGAACGGGCGATCTTGGTCGGCCACCGCTAAGATCA
GCGCCTCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACTCTCAGCAGTCCAAATCCACTTGACGTCCTTCTTCAGGAGCTGTGACAGCGGCCG
TATCATGCCCGCGTAGTCCTTCACGTACGTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACATTCGACGGCGTCGGCCACTCATTG
ATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCACTCGCCCCGAAGATGCATTTCTTCAGGT
TCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTGCGGAGATGCACCTTGTGCATCTCAACGTCGCTCATCCCGTCCGCAGCTCGGCTGTGGAC
GAACACATCGTCGAAGTAGCTCGATGCGAAGTCGCGCACCGAGCGCAACAAGTGGCACCTGTTGAAAGTCGCAGGGGCGTTCTTCAGACCCTGTGGCATC
ACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGCGAGGGATATCGCTCTCACACATGAGGATCTGATAGAATCCATCGCGCAGATCAA
GAGCACTGTAGATAGTGCTCCTGGCCATCCGAATCGATGATGACATCTTTTTGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGT
ACGCATGAACGCTGCGCCAACCGCCCTGTGGCTTCTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCGGCGTCCGAGACAATGCATATTTGCTCGATGCGTCCATCG
TGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGG
ACCCGGCGCAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCCCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCTCCAGT
CCGAGACTTGCGCAGCGACCTTCGCATGCGCTGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGG
TGTTCTTCTTGTATTCCGCCGGCGGGTTCATCACGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACAAC
ACCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACCGTCCGCACCTCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTT
ATTGGTGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAGTTCACCCAATCCATCGACTCCCGGAGTCGACGGCGTTTCGTCA
CTTTAGCTCTTATTATTGGTAAAAATCGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTAGAGG
CCGGAGACTCTTCCTTATTCGCTGTAAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCCAGCTGCTC
TTGCGCGTGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCGTTAGGCGCTGGCTCGAGTGGGAAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCG
GCAACAGGGCCATCGCTCACTGTTCAGCTGTCGCGACCGAAGCGCACGAGAGTGTGCTTCTCCCAATCGATGACCGGATCATGTCGTGCAAGCCACGGCA
TGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGATAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTT
CTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGA
ACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCTGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTT
GGTTCTTGCAGTGAGAATGAACCTCACTGGTGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGC
GCCTACTGGATTCCAGCATTTTTTTTGTTTGTCCGCGACGATGTCCGGCATCGCCGCGTCGACCACCATCTCGGTGCACGGGTGCCGTGCACTCTCGGGC
ATAGTGACCGATCCTTCCGCAACGGAAGCATCGTACATTACTTCCTTGTTGCTGTTGATAACCAACAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGA
CCTCCCGCTATCGCGACCGGAGGCGGTTGGAGCCTCGGCGCATTCGCTTGCAG