Description :
From Genome Similarity Track
Location :
scaffold_1176:1843- 3647
Sequence
1804 bases(100 bases per row)
GTTCCTCGGTAGCGTGTTCCGCTACAATTGGCTACTGGAGACCGTTGTCTCTAGAGCGTTTAAAGAACTATGCTCCAGCTCCATGGGACTAATCTAACGA
CGTCGACTGCGGACCATCTTCAGATGAATGACCAGACGGAATGCGTGGATTCCGTTCTTGAAGACACTTTTGCAAAGTGTCTGTGACGATGCGCGACGGT
CCCGGTCGGGACAGTTACCTATGGTTGGGTTTGCACTCACAAATGAGGTTCACGCATCAACATAGGCTCTCTTGAAAAGATTATAACACCACCAGATACC
GGTAACCCTGCGGAAGGTATCGGTGATACTGCCATAAGTGGGTAGAGGCTCGAAAAGTGTTTTCCTCCCAGGTTTCCGAAGTGAACCAGAGTCGTTACGA
CGACAACTGGCAACGCTTATCGACAACAGACTGACTCTCACCATCCAGATTAGACCGTTAACGGGCATCACCACGACAAACAAATGGTGTGCTCTGACAC
AAGAAGTAGAGGAAACTTAAACGTGTTTGACGTTGGTGACCTAGTTCTACTGAACACTAAAGATATATATATATATCAATTTGGTCAGTTCCGTCGGGAG
CAACAATTTTAAGCGCTGCTTCCTCGGACACTCGTCAGTCGCGGATCCGCCTACATTATCGCCTTACTTAAGTCGATGACGACCCACCCGATGTTTGATG
TGGGTCATCTGAAGCGGTACCATTATCAATAAAGGATTATTGAGTCACTCGATACTGAAACGGGTGCTCCAGGTCTTCAAGGTCGGCCTTTGTCGCCCGC
GACCAGCGCGCTGATGGGGCCCTCGAACCTCACCGCCCAGTGACAAGGCATGTTTAACCCGACCGATCCGCAGTGTTAGACACCATTGACGTGCTCCACC
GTGTACAAATGGTCTTGAAGTTGGTGGATCTCCTCCTCTATCAGAGCGCGAGTACCTGGTCTCGAGAAACAACCGTATCTCCAACAACCACCGCCGAAGG
AGTTGCTCGTACGAGTTATCGAGAGAGATTACCGCCGACTCTCCTCGACTGGAATGAAGAATACCATTACCACGCAGAGCGTTTCTTTCAGGATCCGTGC
CTCCCCGGGGAGCGACAACTGGAGTTAAATGACGTGGCTGCCCGATTCTACACAGCTCATGGGAGTCGATCAAGTAGACTGCCCTTAGATTCTCTCGTTC
TGAGAACAGAAATGGTGCCTCCGTACATACCACTTAGCAGCTGCGCAGCGTGCAGCGGACGCACGAATGCCGTGATCGCACTCAGGAGGGCTGGGTATCT
CTTCATAACCCTGGTGGTTGCGGCCTCACCACGAGGTGAGCGAACTACCCGGAGGTCCAGCCGGATCAAGATGAAATCCAGCTTAGCTTCTACCAGGGTA
TCCTCGATGGCATCACACCCATCTCAAGAGCAAATCTTCGGGCTGTGAAACCGTGGAGGTGTTCTCGGGCGCCAGGGTATCCTCGATGGCATCACATCCA
TCTCAAGAGCAAATCTTCGACCTGTGAAACCGTGGAGGTGTTCTCGGGCTGCACTTACGGGAACCCCCACCCGAGTTGGAGACCACCCTTGGGGCCAGGT
TCCTTACGAAAGACTAGTGAATTCGTTCAGTAGAATTGTGTGCGCTACTAACAGCACACACCTGTCAACCTCAATATCTTCAGTGAAGAGCGGCTCATCC
TAAAAGAGGTCCCTCTTATAAGCTCCACGAGAAGTGTGCCCATTGGTGAACCTACTAGGAGCCTGGAGCCTACCCAAGAACATCGGAGAGCTCAGCCCCT
CTTC