Description :
From Genome Similarity Track
Location :
Scaffold_405:184291- 186627
Transcript NameFunction/comments
Aphin_H310_03826PREDICTED: glucosidase 2 subunit beta isoform X1

Sequence
2336 bases(100 bases per row)
TGCAAAACATGCTACACCAATTTTAAGGGCGACGATGCGAGAGAATGCCCGAGACCATATTTCCTCGAGCAGCTCGACCATCCCGCGCCAATACCTCAGC
GCGCGTCCGACAAGCGAAGGAATGTGTTCGAGACAAGAGCACAACGGAATATGCGGGCACGCTTGCGAACAGAATCGATGGATGTCGTTGAAAAGCCGTG
CGTTGGCGCCGACTACAGCACGGAGACCGATATGCATCCGTTGCGTTGGCTGAACACCAACCACGTCATCAAGAAAAGAGCCCAATTTTCAACGAGGCCG
TTCCAACTGGTTCGGCGGGATGACTGCATTCGCGGCATGCAACGGCAATAGTAGGTTGGCTCTGCGTTCATCGACTTGGATTTCATGGCATAAAGATCCA
CGGCTTGGTCAACGAGGGTTGAGCTTATAGTTCGTCATGCATTGTGGTAACGTCATTTCGATCTGTGGCGCTCTGAAGATGGGCGACGTACTCTTTTGTG
CATGCCGCGGGCGTGCTAAAACCGAGGACGTAGTCGCACCATGCTCGCTCTTCCATGTAAGCGACGTGGTTGTACGAGTCGCAATGCATCTCGACTGTGA
CTCGGCGATACCGTCGGTTCGGGTCATCTCGGCCGCCACAGAGATCGCCGCGGCCGTACAATTGGTTTGGCGGGCGCAGCGCAGACGCTACCCGAGTCTC
TGCGGCATGCGGCACTCCTTCCACATACAATGGTGCTGGGACTAGGATGGCATGGTTGTCGTGAGGGTTTCTTGCGGCCCATTCGCCCCAGAGGCCAAGT
AGAATTGGCGGTTGGACTTCTTGGTCGGTCCCATCGTCCTCGACCACGTACTTATCCCCAACCTGCGCTTGCTTCTACGAGACCAAAAAGCCGGTCAACT
CTAAATGGGGTGGTGGAGTGTACCTGCGCAAGGCGCCATCCATGGTATCCAGGCTCTGTTTGTGTGACGTTTACAAAGGGGCAAAACACCATCAAGTACG
TTCTCGCAATCGTGTTGGACGTGCCGCCTTTGAGCTCCTTCTCGTTCACTTCATATTCAAAGCAATGTCCCATCAACGACGCAAATTCATCGTGGTCACC
GAACGACGTGGACGCCAGCGTTGAAACCTTAGACCACTGGGATTTGGCATGCTGCATTTGAGCGTACAGCTGGTGATACAGGCGGCGATCTTGGTCCGTC
GGCGTCAAACTCGGGTTGATTTGGTACCGGTGGGTCAAAGCGTCAAGCTGGTCTTCCGCTGCTTCGGCAGCACCCTCCCAGTGTTCAACTGCTTGCGCTA
GCGACGCTCGCCACGAGTCGAGTTGCGACGTGGCTCCGACATTATCAATGTACGCATCTTTCACCTTGAGACCTTCGAGAGCGTTCTGTAGGACGTCATG
TAGTCGCGCGTTGGTCTGCGCGGCTACGGATTCACACCTGTTTCTACACGTGTTGGTTGGACCCTCGTCCGAGCCATCGCAGCAATCGCATACTCCGTCC
AACACGAAAGATGACGGCAGTTGGAGGCCAGACCAAGCGCACGTGAAATAACCCACACCACAGGCCCCCGTTAGCCATTCGTCGTCCGAGCCATCCAAGC
AGTCGCAGTAGTTGTCATTGAGTTTGGACAACGCCAACGTCGACGCACAAGACGACACATCATTCGCGGACAACACAGACGGCCGAGACGTTGACGGCCA
CCGCGCATCTAACGAAGCATCGGCTTTACTGATCCATACGCTGACCAGCCATGACACGACCATGAACCGCATCGTTGCGGTGGCGCTGGTGTACTGCCGC
GTGGTTGTTCGGTGGCCATGCAGCTCCTGATTGGTCCATCGAAAACCCGTCATATTGAATGGATACATAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN