Description :
From Genome Similarity Track
Location :
contig_5:184260- 201326
Transcript NameFunction/comments
g1322.t1hypothetical protein
g1323.t1hypothetical protein PHYSODRAFT_476843
g1324.t1hypothetical protein PHYSODRAFT_344165
g1325.t1hypothetical protein
g1326.t1hypothetical protein PHYSODRAFT_349450
g1327.t1hypothetical protein PHMEG_0008030

Sequence
17066 bases(100 bases per row)
GTTTCGGTCTGTGCCACTCAAAGCCGCTCCAACGTGCGGTTGTCGACTTTCGTCTCCTCTTGCAGTGATTTGCGGTCGAAGACCTCATCCTCCTCATCGC
TGCTGCTTTGGTCATCATCATCATCGTCTGCGTCAAGCCGCTGGTGTTTCGCGGAGCCCTTCTTGTCATTGCGAACCATCCCAAACTCTTCCTCGTCGTC
GTCATCCTCATCCTCCTCGCTGCCTTTCACGCGGCTCCAGAGCTGGTCCTTGCCTGTCTTTTGTCTCCGCCGGCTGACCGAGATCAGCATCATCAGTAGA
AAACCAACCACTAGAACTGCACCCACGATCGTGAGCACCATTGGGTGGGCGCCACCTGACGATTTTTCCTTCGCTTTCGGGTCTGCGGCAACACCTGACG
ACGACGACTGAGTCTTTGCGTTCCTTCTTCCGACAATGGCTGAATATTCAAATCCGCCGTACTAGAAGCAAGGTCCAGAGTGGAGATATTTGCTACCGTC
GCTTCTGGAGTCGATGCAGCCGTAACAGTTGGTTCCGAGGCAGCTGCAGCGGAAGTGGGCTTCGGGGATGATTCTACCGTTGCTTCCGTAGCTGAAGGGA
CTGTTGCAGCATTGGTAACAATAGGGACAACGTTGTTCGTTTCACCATCAATGCTACTCGTTGAATCGTTGCTGATGGACGGGGAAGCTGTTGTCGAGGA
ATTGCTTTGGTAGGCACAGTCTGCGTCCACAAAACCCACTCGCTGGTTGCCAAGGTCAAAGATCACATCACGGTTCATCATGAGATTGGCGCCAATGACA
CCACCAGAGTTCTCTGAGAGGTAAATACTTCCACAGAAGGCACCGTTTGCGTTGAGGAGGTACTGCTCAGGCGGCACATCCAGGACAACTTCAGCATTCT
CATCTCCATACGCTTCCATCACAAGCTGGATCGTGGGTAGTGACGCCATATCCTCGTTCGTGAAACCATGGCACGATGTGCCCACCTGGTAATCACGGCC
CGCGACTTCCTTAAACATCTGCAGAAACTCGGTCTTCAAAGCGCGGGGAGGTACGAATCAGTAGTTCCGCTGTCCACAATATAGTGGCCTCGCGTGTATG
CCTCTTCCTTGGCGTTAATAGACTTGCCCCCGATGCGAATGTCCTTCATGTGAACATTGTAGAAATGGCTATAACACATGGAACGAGTAAACCATTAATA
AAAAACTCCACAGCGGAGCAAGCAAGCCAATTGTACCTGGCAGATCGGTCAGAGATTACTTTCGCGTAGGAAATTTCACCTCGGTGTGCATTTGTGTTCG
CTTGTCCAACCGACATGGTTCCGCCTTGATCAGTGAAGCAGAGCGAAAACAAGTTGCTGGGAATTTTGTTCTCGCGATGGAGCTTCGCAACAATATGGTT
ATCCGCGTTGGACAATCCCATGATGCCATCCGCCACCTGAGTGACGAACAACCCCGTTTCCGAGCTCTGACATCCGAACTGGAAATGCGTGCCGTAGCGG
TTGCGCATCTCCTCATCCTGGAAGCTCGTTTCTCCTCCCAAGTACACGACATCCTCGACCACAGAGGCCTTCCAGCTGCTTCCCTCCATGTACGACTGAG
AGATGCCGCACGTGTCCGATGTCTGCTTGCACTCCTTACACTGAAGAACGACTGCTGAGAGCACGTCACATGCACCAACGTGGACGAATTGTCTGCCATG
AAAGGTTGGTCCGTGTGGCTGCCACATCCGTCGCACCCCGAGCACGGGAAGGCCATGAGTCCACTGCCTGTGTCCGCGATCACCGACGCTCTCTGAGGCG
GGGTACCAGCATATACCCATGTGTAGTGCGTTCTGGATCAAGCACACGGCTTCATTAGACCCCCCATCCATCACCCAACACTGTAGCAACGCTGCACAAG
GCAGGATCAACGTACCCAAGTCCCAAATGCAGCGGCACGAGCTCCGGCGCGTCTTCTTCGATGTTCAGACGCCTCGCGTATCTCTCGGGGTGAATCTCGT
GCTGCGGCAGGCGGTGCAGCTCCATGGTCATGCCAGCGGATTGTGCAGCCTCCGCCAGAGTAGTTATCGTCGAAATGGCAGCCAGCAACACCGGAATCCT
GCGTACACGTGCACCATCTTGAGTCTCTGAGTGTTGAGCCCCCTGTGTCAATTCTGCGTCGTAGGCGGTGGTTGGACGCTGGGGATCTCCCTATCGAACT
GGGCTACGTGATGGATGGGTGCTGGGCAGTGGTACCGGTACTAACCACACAGTGTGAGGAAGAGGGTCGCCGATGGGAGAGCGAGCGCACGTGGCAGTTT
CCTCCTCAACGTCTTGTGCTCCCTATTTTCGCTGAAACGACGACCCAATCGTAAATGTGAAATGAGCCCAAATCGTACTTTGTGTTTGATTTAGAATTAG
TTTGGGTCCCGCAGCACGCACGAAAGAGCCGGAAAAAGTATCTTTCAAGTGCTGACTCTCTTAGTCCGTGAGCGCCATTTCGTGGCGCAGTAGCGTCGAC
CACGCGCTGGTGTCACGGCGTTGGCGTTGGCCAGGAGAGAGCAGCTCATTGCCGTCGTCGAACGCTTTCTTGGCGTTTGGCTGCACCGAGAACGCCCGCA
ACGTGGTTGTGGAGTCAGCCATTCGACTTGCCAGGCCCACGAGGGGGATGCCAAAGCGAGAGTGAGGTGACCAAGCACCGCGAGGTGATGCAGCAGTGAT
TGGGTCCTTCTTGGCGTTGTTCTGAACAAGAATATCATGACGGATTTCGTCAGCAGCTGCTGGCATTTTCGGAGACACGACGCGCCGGGACTCCATGAAG
ACACCCGTGTTGGGCTCAGTTGGCAGCGAGGCTTTCATACTGAGCAAACGCTTGCGGAGGTCATTCTCACCCGGTCGACGATGCTGTGCCAGTAGGGCGG
CAGCTTTTAATTCCACTTGCGAACCGTCGGGATGGCCCCCTGATTGCTGCTGCTGAAATGTCGCCTTCACCCGTAGCAAGGTCGGCATCCCCCGACACAA
ATGAAAGGCGGTGGTGTGGAGTGGCTAGCTGCTCTGCAGACATGACGCGAAGTTCACCTGCAAGTTGTAAATCTGCTTTGACTTGCTCAGCACTATTGTT
CGACCCGTGCGCAAACGGAGGGAAGTCACGCTGTTCCGCACGGAGAAGTTTGTGTTGGCTCCAGGCAGAGAGGAACTCCACGGCTGGAAGCAGCGTTCGG
TGATCCTCCAGGCTTTCATCCACCCAGTCGATTTGCTGTAATTGTCGTTCAAACTCGAGCGCTTCGCCAGACAACACGCGCGTTTTAACTGATACCGCTT
CATCCAGGTTGCGGAGAGCACGTGCACTGCTCCTTGATTGCGGCTGCGACGTGCGTCTTGTTGTCTTGCACGGCCCGTTGAACCCTGGTCAGAAACTGTA
GCTTGTTCTCGATCACAGTCTTGCGGGATGTGATCAGTGGATCAGGACGCAATGACTCCCGTAGACAGCTCTCGTACGCATCTGCAACAGTCAGCAGGCG
ATGCGAACCTTTCTCTCCAATCGAGTGGTCTCCAATCATTTTGCAGCTCACGCACACAGGAACCTGGCACACGGGACAATAAAACTCCACTTTCTTGCCA
CGGTGAGCGGCACGTTGGTGTCTGTGTATCATCAGCCAGGAGACCTTCTTCCATTTGCTTTACAACGATCTCGTTGATGTGAGCCTCCGTCGGCTCCGCG
CTGCTTGGCGGGTTCACGAGACTTTCCACGCCTACTTCCGCAATGGCAGTAGCAAGAGATGGCGTTGAGCTTCGACGTCTGCCGCGTCTAGCACCTCCGC
TTGCTAAAGCTTTTGATTTACTGCGCAGAGGTGTACGCTTGTGTCGACGTACCAACTTGTTTGCCGAGTGGACTTCTTGGTCGCAATGAGCACAGATCTG
TGCCTCGCAATTACGGCAGACAACAACAGCGGGGTGCTGCTCACATAATGCACATGATCCCACGGCTGGACCATGTGCATCGGCTGCGGAGAAGGTGAAT
CGCACGAGGTACTGGGGCAAGACCTGAAGTGTGTTGTTCAAGATGTACTCGTGGTAGTAACCGCGATCCAGCAGTGCAGACTGGAGATCACGCTCCTGCT
CCTGCTCATTCGAGCTGGAGCCTTCATCACGGTGCAAATAGTAGCTGTGGTAACCAGGTGGAAGGCGTGCTTTGGCCTCTTCCTCTTCATGAATAACAAG
AGATCGTCCAACCGCAATCTTGCAGAGCACGAGCTGCCGCGTACTTGATGGCTTCTTTGCCTCTGCTGGAGGCTCCGGAGGAGGTGGAGCACTGAGCTGA
AGGTTTCCTGTGGTGAACTTCATCCCCGATTGGTTGGCATCGAGCGATGTGAAGCCGTAGCTGTGGACGTCACCCATGTCAGCGCCAAGGTCGTTTACGG
CGACCCACGACTCGAGCTCTAGCAATCCTGCCGTGTGCTGCTCATACTGTGCCACCAGAGACGGATTGCGCATATCCCAGATAACAACGCCCTCGTGCAC
ACGATACCCCGGCAACGAGCACTGCAGCAAGTACCTCACGCGTGCAAATTCCTTGGAAGACTGGCTCATCGGCGTCACACTTGCCACTGCTCCTGCGGCA
GGAATGGTTGTCTGCCCAGCTTCGTCTTCTTCGTCATCCACTAAAACTTCAGGATGTGACCCCGTTTCGACGCCCCATTCAGAGTATTCGCCTGGCGGTG
CTGCTGACGAGGTGACTTGCGAGCTAGCGTCGTCGGAGCCTTCATCTTTTTGAGCCCCCTCCACTGGACGCTCGGGTGATGCAGGCCGAGCAGCCTCGCC
TGGTCCATTCGGGGAATGCGACGACAAGAACAGCCGCAGTCGCGCAAGCGAGGCACTTGCCTTCGCCTCGTCGGCCTCGTTCACTACCATTGGTACCAGA
GTTCAGCCAAGGAGATGATCGTCGGTGCGTTTTAGATGCCGTCGTTTCGGATGTCCTTTCGTGAATTGCGTGAGTACAATATTGGATTGAGCTCACGAGC
TGGGAGCTGGGGTGGTGTATCTTCCTTCACTTGCAATTTTGCCGTACGGCCCAATCGCAGTCACCCCGATAGAGCAGTGGACCATAGTCCATGAAGCGCC
ACGCCTTCGCAGTGTGCTACTAGTAACGTAGTCTTAAACCGACTGCACTACGCTCATATTTGCTTTAAAGCGGACACAGCGGCAACATCGCTAAGAGCAA
TGCAATGCAAAGCGACAGGCACCATAAGCTCCAGCTGCAAGCAATAGGTCCTCGCCGCAGCAATCCGTTGACAAAACGGTCGCGGTCGTTCGAGATTGCT
GCAGCAGCCCAAGGACAACCAAAAACTCACGTCGCAGCATCAATTCCGTGCTGCAAAGGACCATATTGCAGATCTGGTCGCTCCCAGTCATCGGCACCAA
CTCAAATCGAAAGCGCGCCAATGGGACACTCAGTTCCCGCCACCTCCAGCCGTCCAACCAATTCAAATGGCCGTTCTCTCTCGCGACCAAGCGGGTTTCC
TTTACGGCCCGTTTTCAATACAAACCCAAGTCAAATACGGAAATGGGCCGTAATTTTGGAACCCGTAGCTCTTCGAGTCAAAAAGGCGTGCGCAGCCATT
CGGCCATTTGCTTTGTCTACCCATACATCCCACCATGAAGTACCTGGCAGTGACCGGCGGCACCGTGAGCGGCCTGGGCAAGGGCATCACCATCAGCAGC
ATCGGCGTCGTGCTCAAGTCGCTGGGGCTGCGCGTCACGTCCATCAAGATCGACCCGTACCTCAACTGCGATGCCGGCACCATGTCCCCGTTCGAGCACG
GCGAGGTGTTTGTGCTCAACGACGGCGGCGAGGGCGACTTGGACCTGGGCAACTACGAGCGCTTCCTGGGCATCACGCTCACGCGCGACCACAACATCAC
CACGGGCAAAGTCTACACGCATGTGCTCGAGAAGGAGCGACGCGGTGACTATCTGGGTAAAACGGTGCAGGTGGTCCCCCACGTCACGGACACCATCCAG
GACTGGATCGAGCGCGTGGCCCAGATCGGCGTGGACGGCAAGCACGCCGGCGAGGCTGCCGCTGTGGACGACGAGGCCGCCGATGTGTGCCTCATTGAGG
TCGGTGGCACGGTCGGCGACATTGAGAGCATGGTGTTCCTCGAGGCTCTGCGTCAGTTCCAGTTCCGCGTGGGCCCCGAGAACTTTTGCCTCGTGCACGT
GTCCTTGTCCCCGTGCTCGGCTCCGTGGGTGAGCAGAAGACCAAGCCCACACAGCACGCCATTAAGGAGCTGCGCAGCGCCGGACTGTCCCCCGACGTCA
TCATCTGCCGCAGCAGCACCGAATTGGAACCGGGCACCAAAGCCAAAATCGGCATGTTCTGCCAGGTGCCGGCCAACCACGTGCTGTCGGTGCACGACGT
GAGCAACATTTACCACGTGCCTCTGCTGCTGTCCAAGCAGGGAGCTGCTAGCATTCTCATGTCCAAACTGCAGCTGATGGACCGCTTCTGCGAGCCGGAC
CTTGAGGCCTGGTCAGCCATGGCCCACCGCGTCGATTCGTTCGAGCAGGTGTGCAAGATCGCGCTCGTGGGCAAGTACACGGGTCTGCAGGACTCGTACC
TGAGTGTCATCAAGGCGCTCAAGCACGCCACCATGAAGTGCAACCGTGACCTAGAGATCGAGTGGATCGAGGCCAGCGACCTGGAGGTGGACATGCGTGA
GAACGACCCCAAGGCCTACGAGGAGGCCTGGCGCAAGCTGCGCAGCGTGGACGGTATTGTCGTGCCTGGCGGTTTCGGTGACCGTGGTGTGGACGGCAAA
GTGCTCACGGCCAAGTACGCTCGCGAGAACCGGATTCCGTACCTGGGTGTCTGCCTGGGCATGCAGGTTGTTGTGATCGAGTTTGCGCGCAACGTGATCG
GCTGGAAGGAGGCTAACAGCGAGGAGTTTGACGCCGATGCTGAACACAAGGTGGTTATTTTCATGCCTGAGATCAACCCGGAGGTCATGGGTGGCACTAT
GCGCTGCGGTGAACGCCGCACGATTGTGCACGAAAAGGAGGACCCGGCGAAGCGCTCGCTGGTGTCTTACCTGTACGGTAAGGACAAGCCGATCCTGGAG
CGTCACCGTCATCGTTACGAGGTGAACCCGGAGCTTGTGCCCGCCATTCGTGAGGCTGGTCTCAACTTCGTCGGCACGGACGAGAAGGGCGAGCGCATGC
AGGTCGTGGAGCTCGACCGCGACGTGCACCCGTTCTACTTCGCCACGCAATACCATCCGGAGTTCAAGTCGCACCCGAGCGACCCGTCGCCGCCGTTCCA
CGGCCTCATTCTCGCTGCCACCGGTCAGCTCGCCCAGTTCATGAAGGACGTGGAGGCCAAGGAGCAGGAGCTGTAAGTGCTCGGGCGATTCGAGCTAGAG
GCGGTGGAAATTGCTGCGACGCAGAGCAGGTGGACAAGTGGCGCGGCAGGACGCAACGACGATGCCTCTCTCGCAGCAGGTTTGCGTGTGAATAGGCTAA
AATATTGATTTGGACCCCTCCACTCCGATGTCTTTGCCTTTGTTTTTCTTCGTCGAAGGAAAACGGGGCGAAGCTCTCTCGGTGGGGTTCCGTGACCAGC
CCACGGCCAGGTAGAACTAGCGTTAGACCAATAGACATATATTTATTCCAACTCAACCGTCTGATTGTCCGCATGAACGCCAGCGAGCCCAGCACTAATG
CTTCGGCCACATCGTGCTGACGCACTTGGTCCAAATGGCTACATCTGAATTTGCTCATTTTCGGCGAATCAGAATGCTTCGAGTGGCACTCAACGTGGCA
TTTCCGAAAATGTCTGAAGAGCTGCAGGAGGCGGTGGATGGCTTCTTCCTGGCGGCGGAATACGGCCGCTCCGACGTCATCAAGGCACTGGCGGACCACG
GTCGCGGACGCCTGTCGCTTGGAGACGTGGTGGATCCCGTGACGGGGCGCTCGCCGCTGCACGTGGCCGTAGCGAGCAGCAAGAAGGACGCGCTGCGGGT
TCTGCTGGCCGCTGGCTTCCCCCCGCACCATCAGAGCAAGCAACAGGAAGGAAAATACACGTTAGAGGGCGAAAATCGGTCGGCGTACGCGCTGGCGCAG
CAACTGAAGTCGCATGATTTGCTGCTGGTGTTCCACCAGTTCCTGATCCAGCAGGTCGCGGCCAACGACGTGCAGAGCGTCACACAGTTACTGACGGCTG
GCGTGGATGTCGGCGTGACGGATACAGCCACGGGAGGATCGCTGCTGCATTGGGCGGCGTCGTGCCAAGCAGTGGAGGTGATGAGGGACCTGCTGGAGAG
AGAAGACGTTCAGAAGCAGAAGCTCGTGGATGCTCGCAACGGGGAAGGAGCGACGCCACTGCACTTGGCGTGTCATGCGAACCAGGTGGAGTGCACCAAG
CTGCTGCTACTGCATCATGCTGATATAAGTGTACGGGGTGAGAAGGGGGTCAGTAAGGACAAGACGGCGTTGGAGCTGGCTACGATGGCGGAGGTGATAG
AACTGTTCTCTCAAGGGCTAGGAGGGAAGAGTGAGGTCAGCGAGCCCAGGGAAACGCAGAGGGAGGCTTCAAAGGAAGGAGATAAGGATGCAAGCAGCAA
TGATGATGTGTCGTGCAGATTGATGACGGTTGGTGGTGAGCGTTCTGGGGCCTGCCCACATGAAGCGCAGAACAGCAAACTGTTGCTTCAGCTCGAAGAA
AAGGATCTCCTGGTAAATCAGTTGAAGAAGACTATTGAAGTTCTCGTGCAAGAATCACAGGAAATTCAAATGCTCGGAGAAGAGCGTGTGATGCTGGACT
ATGTGCGCAAGCTGCGCGATGAGAAGGCTATTGCCCAGAGGCAGATTGAGGATGCGAACGACTACATCAAGGACCAACAGCAGCAACTCGAAAGCTTGAA
GGAGCAGATCCGACAAACATCCAGTGCCACCAAACAGGTAAGAAGATTGTTGCTGGCGTTAGTTGGCTGAAAGTGGTGTTCTTACGACTACTTCTTTTAT
GTAGCAGCTTGAGACTGACCACGACATTCTCTCTCATACTAGTGATGGTACGGCTAGCAGCGTCGCTGGGGCCCCTCCGAATAGCTCCAACAGCAACACG
AATGCGCTGGATTTACACCAGCTCGATACACAGTTTGATGAAGAGGACGAGAACTCACAAGAACCCCGAGCTCAAGCACTGAAGTTAGATGCCTGGACAT
CGAAGGCTCAACGTGAGCAAGAAACATTCAATCGATACGTCGAAAAGCATGGTCCTGACATTTGGAGTACGGTGTGGAACGGTATCTTTACAGGCAATGA
AGAGAAGGAGACGCACGATGAAGACGGCGAGGTCATCATGACGGTGTAGAATGAGAAACAAAGTGAATTGAATGATTTGCATCGATGGAAACCCAGCAAT
GATTGTATCCCGCTACCGCATTGGCGAGGTAGCAGCTGCAGACGTATCCTGCTGTTGCTGCTTGTAGACGCTTACGAGAAGTTTCTCCCGCTTCTTGGGT
TGCTTGTATAGTGCACAATTGTTTGCGCACAAGTGTGGCGACGAGATTGAATTTTGTCCAGCCTTACCACACGAGCAAAGAGCTGGGGTCCCAAGTTGCG
CTTGAAGTGCACGAACATAGCGCTCGTGATCTTTTGTCGCTGCTGATCTCGTTGCACTCTTCGTTTTTTTCCTTGTGAAATTGCAGTGAATGACTACGAG
CAATTCCAAGGTGCATGGCAGTAAATGTGTCTTACCTCCACGGAGTCGACGATGTGGTAGTCTGACGATGTGCTCGTGCCTCACATCCCGACGATATATC
AACACTGGCCACGACAACGTTAGCTCCAAACGGACCATACCAAAGAGAAGGACACTTCCCACGCACACTTCGACACCCGCGGAGGTGGTCCATCGATTTC
CACCGCTTTCGTCTCCCGCCTTGCTAGCTCGACGAGCCCTGCTACCACTCACAGCTGCTGCAACGGAGGAATTTGAGATCGGGGACTTGGCTTTGGTAGT
GCTGGGAGACTGGGAAGCTCCTCGCCAAACGTTGCTCTGAGCTTTGGCTCGATTCATCTCCATGTACTGTCGCCGCACCAAAGCATACAGAGCGACGCGC
TAGTGTAGTCAAGAAATGTTAGCAACAATTTTAGATCGACTTACCCGAAGCCGAATGGTGAACGCTACACTTACCTGCTCAGGCAGCAGAGTCGGAGATT
CAGTTGGTTTGTTCTCGGTTTCACTCTCTGTGTTCTCAGCAAAATCGTTGCTAAGAACCACTGAGCGTGCAATCTGAGTCGATTGAAGGAGTTCGTCACG
AATTTGGGCATCTAAGCGAAAGCTCTAACCGCACATAGAGAGATACATTCACGTGTTATATTCATCAGAAGGCAAGGTAGAACCTAAAATGCAACATGTT
ACCTTTTCGATTTGATGGCCTAAAGGGCAGCTCTGGTCGAAACAAGTGTAAGACGAGCGAATTGAATCAGTGTGAACAACGTAGACAAACCTTTAGTACG
GCCCTCTTCTGCTCCTTCAACTCCTGAAAGTATGGACGGGTCGAAATTCGCAACGCTGCTGTGCTTTCAGTTTGCTGCGTCGACTCTGTCGTCGAAAACA
ATTTTGCACACTTTGCATCCTACTCGGCGATGTAAGCTCGAAGCAGCACTTCCTCAAAAAGGCTTGGAGCCACGCACCAAACATTTCTGCGTTTTCTGGG
CTTCAAGGCGATTTTGTCGCTCTCGCGCTGTCACGCGCACGCAGATTTTGTCGTGGAATCGTTTTAACTCGTTCGACTTGACACGCAATCGGTCTTTGCT
CTCCTGCCGCATGGACTCTGCTTCGGCCTGCCCACAGTGTGTGGTGTTATTTTCTCTATTCAAACGCCATACCTCTGAAGGGAAAAGCGTGTGATCACCT
CGACATCAACAACACTAAGGTCAAGCCAGTCGGATTCCTCTTCATCATCTACAAATCTATAATCTCCATATTTACCCCTGTAGAAAACAGAAACATGTTA
GCTTTTTGTTGTCGCCTACAATAATTCTTGAAATGGTTTACTTGTCGACATGGAGAGTGGGCATGGGAGGTGAAGGATAAGCTTGAAAGCGTGCCATGGA
CCGACATGGTGAGCAATTCTGTTAGAATGCAACGAGAAGTAAACATACCATAGTCTCTCTCTTCTGTGTCTGACGCATTCATTGCGACTACAATCTTGAA
AAGACGCACACAAAATCTGCAAAAGGTCGCGACGTTCATTCGTGGGTAGACCAGCATGCCAATGACACAGTACTATCATGTGCGCGATCCTATGGAGAAC
CTACGCATTAGCGTGACAATACGCAAGGTCGGTAAGCGAAAGTAGCGCTGAAAGGGAGACGCTCACAGGCTAACTGGCGAAGTGACAGATCTCCGGGTTC
GGGAGTGATTCAAGTGGAGACTCGGTTCCGTGGGCAGGACATGAAATATTGCTTCCGGTGGCAGGAAAAAAAGCTTAGCATGAGGTGCGTGGATGGTTGT
ACTGTCAGCAACAATAGCAATGCAACTGAGAGCAGTTCCTATTGCATTGTACAAGTGAAACGAAGCGAGAGCAGGAGAGTCTGGAGGCAAGGGGGATTCA
GTTGTCGAATCGAAAGGTGTGTACAATGTTGCAAAGAATAAACGATGCAACATACAGATAGATTTTCTTTGAAAAAAAATGCAGCGCGGAGATAGAAACT
TGCCCAAGATTGCCAACGCCGATATTTTATCGACATATGTCGATGTCGACGACTACGTTCCAAAAGAGGTGGGCGCTATAACTTTATGTTTTTACTTGCT
GCGGACTCAACAATGGGATGTACCATTCAAAGGAGCGACCAAGCACATCGATGAACACAACAACGCACCTCATTCCACCAGATCTCACTCGACGACCGCG
AGACAGACGAAATGAATCTTCATGGACATCAAACCAGCATCGTGCGTGGCTCCGAGCAAACCGTGAAGATAAATTTCGCGCGATGCACATTGTTGCTCTT
ATCGAGGAGGTGGAACGCGTGCTTTGTTCGTTCCGGTTTTACAAGGAAAGCGGATTGTTTTGTGCGACACCAGGATTTTCAGCGCCAATCGTCGACCCTG
AAAGCGATCCAGACTTGTTCGTAAAGGGCCCCAAGCTCACCACGTTTCACGTGTCAACTCCGTCGGGCTCCCTCTATGAATACGTGCTAGACAACACAAA
TGACCTACTACCATTTGCCTCCGCTGAGGACCAACGTCTTGCACGAGAAATCCGCTTGCAAGAAGAAAAACGTGATACAACTGAGGTTTCTCGCTGGCAA
CAACTGGATAACCCCCCAAACTTGTCGAAGCAAGACCTGGTGGCTCTGGAAATACGAAACGCAAGTTAATGTTATCACTTGAAGTGGTGACTGTTGATAA
TCCACAAACGATGAATCCGGTCTTTGTGGAGTATAAACTTGTACTACCTCACGGCATGGGTCATCTCGATTGGAAATTGCAACCTGGAAATTTCGACTGC
AAACGGGGTAGGACGCCGCTATCGTTGCCTCAACAATCCCCATCACTGAATGTGGGTCTTCTTCGGCAGCGTTTGGATGGCTTGAACACTTCGACTTAAA
ACTCATCGATGTTGAGAAATCGCTTTTAGCAGCAGAAACTTCGTCCCAGGCAGCTAGAGATGCTGATTTCGGCAACATTATTCCCGCTCCAATCCTTTAT
TTGAGCGTGTATTCACTGGATTGGTGGCGCCGAAAGCACACAGAGGGCCATGGGGAGATCGAATTGCAAGGATCCTCCGGATTTTACGACTTTGATGTGC
CTATCCGGAAACCGATTACTTCCATTCGTGATCACATGGAGGAACTTTTTCTTGGCATCGGTGACAGTGACACCGACCAAGACTGGAATGCAGATCGATC
CCATGACCGAGAAATCTGCACTGACGAATCTCCGATATCGACTATCATCACAAGCCGATTGGGGCAAAAGTCAGAGTCCACAGGCTCCACCGTACGAATT
CGTTGGAGCATATTTGACCTGCGTCCAGCAACTCACGCAAACGGGATAGTAAAAGTAATGCCAGCAGCTTCTGTTGCGCCCTTGGCTAATACGAAGGTTG
TCAAGCGAAGCGTGCAGGAAATACTGCAATCAGTAAAACTGGAGAAGAGGTTGGCTAGTATACCAGATGTCCGTGTCCAGACGGCTCTGCGCTCCGTGCC
TGCCGGCGGAGTGGCAGCAACAGAATCACTAATAGACCAAAGTGCTCTAGTTTAATAGCGACGGCCGGGAACGACCTCAAAAGTGTATTGCGTAGTTGAA
TCGGACAGACAAACACGCTTACTCATCGTCACTGTCCAGATCGTCCAGCGGATTGCCGCTGCGCTTCTTCATGACGCGGAAGAATTCCTCCTCGTTAATG
AGCCCGTCTCCATCGCGGTCGGCTTCGTCGATCATTTCTTGCATTTCTTCGTCCGTCAGCGATTCTCCTAGTTCGGCGCACACGCGCTTCAAGTTGCGGA
AGGAGATCTTGCCCGTGTTGTCGTCGTCGAAGAGCTGGAAAATCTTCATGATCTCCTCACGCGAGTCTCTCGAGTTCTGTCAGAGGACACCAAGAAGACA
GTAAACCTTAATACATCGAGCCGATTCTCCCCTCATAGTCATTGCAACGAACCATTTTCCCGGTCATCATCTCGATGAACTCGTCCTGGTTAATCGTTCC
AGACTCGTCCTTGTCGATGTCTGCAATCATCTGCCGGATCTCTGCCTTCTTCACCTGGAACCCCAGTGCCCGCATTGCAGCCTTGAGCTCACGCACGTCG
ATAGAGCCACTGCCGTCCGTGTCGAAGAGATGGAACGCCTCCTTGATCTCTCAGGTCTTCTTCGTCCAGCACCTTCTTTACCGGCTTGGGCTTGCGGCGC
AGCGCAGCGCGAGACCGCGCAAAAGCCGACGCGGACATGGTATTCGACTACCACGAAGCACAACATCAGTCCGTCAAATGTACGTCGTCACGTCAAGCAT
GACGCTAGACGAACGTACCATTTCTCCAGCGAGCAGAATGAAAGTGTCCGTTGCAAACCAATGGCGACCTTTCGGGTGCACACTTCAACGTGGAGGTTCT
ACTTTAATGACCGAACCTCTTTCGTAAATTACAGAACCCGGTTTTCTATTCCGGTTCGTGGGTCAGACAACTTCCTTCCTGCCGTCACACTCTTCAATTG
ACCAGCACGCACTCACTTCCTACGACCTTTCAGCGCGATGCTATCGGCAGCAGCGAAGCGTATGCGACAGAGCACCATGCACACGCTCAAGGCCTACGAC
AAGAGCGAGCACCGGCTGCTCGTCGTGGGCGCAATGGCTTCGTGGGCAGCAACATCTTGCAGCGCGCCGTGCAAAAGGGCATCGAGGTGCGCAGCCTTAA
CCCGTCGGGCAAGCCGCAGTGGCAGGACGTGCCGTGGATCGACCAGGTGGACTGGCACGAGGGCGACGTGTTCGATGAGAAGCAGCTGGCCAAGGCCGTG
GAGGGCGTCACGGGCGTCAGTACGTGCAGCTCTCCACAGACTCGACGTCTTTTGTATTGACGACGCATGGTTGCTGTTGTTGTTGTGTAGTCTCCACTGT
AGGCGCGTTCGGCAGCAACGAACTGATGGAGAAAATGTGTGGAGACGCGACGATTCTGGCGGCGAGAGCGGCGCAGAAAGCAGGCGCGGAGAGATTCGTG
TTTGTGTCTAACTCGCGCGTGGGCTCGTATTTCCCGCCGTGGCTGCCGATGCATGGCTACTACAATGGAAAGGAGAGAGCCGAAGCTGCTGTGCACGCGA
GGTGAGACGTGAACTGACGGCATCTATTGGGTTTATTCTGTTGCTGACAATTTTTCGTGCACTGTCAGATTCCCAAACACTGGTGTGTCGCTGCGTCCGG
GTTTCATCTATGGATGGCGCCGCACGAAGAAGGGTCAAGGGATTCCGCTGCAACTTGCGGGGCTCCTCTTTCGACGCTGGCACGCGACCTGGGCGCAGTT
TCAACAGCGCTGGGCTATGTGCCGTTCGTTGGTGAGGAAATGAAAGCTGCTATCCCTGTAGGTGCCGTTGCCAAGGCTGCAGTGCTCAGTGCGATCGGCC
CTGTGCACGGACAAACGCTGGACACGACGAGCATGCTCGAGATCGCTGCCTCTTTCCACGTCCATGAATAAGAGTGCGATGAACTTATCCAGTCGACGAG
GGCAATGAAATCTGGAACTAAATCAATTCCAGCGACAATACCATAAGGCCAACCTCCTAACTCCAAAATTGACGGGTGAACTCAAGGAGGGTATGACAAA
GCTTTCATTACCGCGTTTATCTTTTCGCCATCGCCTGAGCTGTGTACTTCATGCCTATGACACCGATTTTCTTTTTGCGATCTTCTGCTTCTTGTCGTCG
CTTTGCTAATTCCTCCGTCCGATCCTTCCAGTATTGCTGTGAAGATAAACGCAACCATTCCATAAGCCTCACGGATATCGCTGTTGCAGCTCAACAGTCA
TGGCGTACCTCTTTCTGCTTCTCCTTCTGTTTCCCCAGATTTTCGTTCAAACTCTTCGCGTCAGCTTCATTTTGCTCTGCTTGACCAGGTAGACAAAGCT
CTTCCAGGGTCTGCACCCAGAGATCACGGACGCTTGTCGCTCCAGCTGTGAGCTCAAGCAGTTTCTGGCCATTCTGCCCGAGCAGTACTAGATCGAGACG
ACCTATGCTCACAAACGGCCTTGTTAGCAACAACACGAACCAGCAGAAAATGGCTGTACGTGCCGTACCCATGGGACACACTTTGCCAATCTTGTGAATC
GGCAGTTCCTCCGAGTTACTTGGACCGGGCGTCTGGCGCCACACGAGCCTGCCGTTGATACAGATACTGGTTCAGTGCTCGCATATCATTCAATTTTGCC
GTTCTAGCATCCTATTCAACCTCGTAGCTGACGGGTTCAGCTGTAAGTAGACACTTTCTGATCTGCTGAGCACCCCCAGAAAGGAACTCTTTTTCTTGAA
ATCGTTGCCTTCTTTGAGCAGCTCCTGCCTCGCCAGCATCTCCGAGTCGCCACCACCGCAGCACACATTGCCCATGTCCTTTCCTCCTGTAGCAGGGACT
CAAATCAAAAATACAAGTCGACTAGAATAGGTTGACAAGCAGTGTGGAGTGCACGTGTATTTCTCAAAGCTTGTTGGAGAAATCAAGAATGAAATCGATA
CAGAACAGCTTTTCTCGCTGCTTGGCGCGGCCTAAGCGATGCTAGACAGAGAAAGTTGTCGGACAACATAGAGACGTGATGCTTATTTAGCGGCGCAGAG
ACTTGGTAGCAGACTTGGCAGCGCAACCACCACCCGAAGTCGGGATAGTGCTCGAGCCCCATGGGGAACCCTTCGTGGCATCACCCGCACCACTGGTAGA
GCTCGCGGGGGTAGCAGAGGAGCCCCCGGTTGAGCCTGCTGCGCTCGAACTGGCATCGGAGGAGCTGGGAGCAGACCACCCAGTGCCCTTGGTGGCATCC
GATGCTCCCTTGGTAGCATCAGAGGCTCCAGTGGTTGAGCTCCCTGCACTCGAGCTAGCATTCGAAGACGCAGGCGAGCTGGCAGCAGTCGACCCAGCGG
CGGAAGTGGTGGAGCTAGACGCACCACCTTTCGAGGCGCACGTTGTGGCCTTGCCCGGAGTGGTCGTGAAAGCCGTCACCGTGAAATCGGGCTTACCGCC
CTTCTTCCACGTGCAGCACGGGTCACCAAACGCTGCACCGTTAGTCATGCTCGAGCTCGGGAACTTGGCTTGGCACAGACTGCTGGACCACGTGTGACCG
GCAGCAGCAAACGCTTGAGCAAAATCCGTCGTCTTGGAGCTGTCGTCGCCAGGGTGACCGAGTGCCTGCTGGAAGGAGGTGCCGTTCGGAAGCTCGTTGA
GGTACTTGGCGAGACCCATAGCGGGATCCACCGTGGCGGCGATAGTCAGAGCAGCAGCGGCGATGGCAACTTGGATCTTCATCTTGGTATGGCGTGTTCT
GGTTCTGGCGGTGCGAGGTAAATTCAGGAGTGAGAAGTGAGAACTTACCCGTGTTGACTTTTCCGA