Description :
From Genome Similarity Track
Location :
Scaffold_145:18421- 25784
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_145-fgenesh-gene-0.9Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_145-fgenesh-gene-0.4Glucokinase
Pytiw_DAOMBR242034maker-piw_contig_145-fgenesh-gene-0.5Lariat debranching enzyme B
Pytiw_DAOMBR242034maker-piw_contig_145-fgenesh-gene-0.10WD repeat-containing protein 82

Sequence
7363 bases(100 bases per row)
CCTGGCCGGATACGTGTGGTGGTCGTGGCGGTGGTAGAAGTCGTGTGGCGACCATTTGCGGGGCTCCTTCTTCTTGTCGCTCTGGAGGCAGAAGCCGCAG
CAGCACGGGATGTAGCAGAAGCAGCACGGACACGGACAAAAGATGTAGAAGCGGCAGACACCGCAGAGCGTGACCCAGAGCACCAGGAGCACCAGCAAGG
CGCTGATCGTCTCGGTCGCATCTGAGTTGTGGAGGCTCGCGAGCAGACCGGACGACGTTGCGGTCGCGTTGGCTGCGTGGGCAGCTTGGGCAGACGCGTT
GGCTGCAGAGGCGATCGCCATCTGCGCGCGCGCGAAGCTCTCCTGCGCCTGGAGGAAGCTCTCGTCGGTCGGGTACCACATCGCTGCTACTGCTTCTTGC
TTGCTTCCTTGGATCAAATGCTGTTGTGGATGCATTTTGGCGGAAGTGAGAAGACCTCTAGTAACAGCAAATTGTGATTAGCAGTTTTACAGAGTTTTGA
AATATAGAAGCAAATACAAAAAGCAAGGTAAATTTACGTAGTGATCAATTTTCAAAAATAAAGTATAAATAGGTAGATTATCGCTAATGCGAACCAGACT
CGTTCCTTTGTCAACCTACAATCTTGCATCGTGCGAACTTAATCGCTTCAATCTGACATCAGCAACCAGACAGAAAGCAAAATGATGCTGGCTGCCGGCG
TGGACATTGGCGGCACGAGCGTGAAGGTGGGCGTCGTGGACGACATGGGGCGCGTGCTCGCGAGGGCGCAGCAGCAGATCCACGCGAGTGAGCAGGCACC
TGCGCAGGTCGTCACGCTCGCCTGTGCGCTGCTGCAGCAGGCGCTGGACGAGGTGAACGCGTGTCTGCCTGACGAGGCGACGCTTGCATTTATGCGTACT
TAACGCGTTGTGTATCTGCGTAGCTCCAGTTCACACATCAGCAGCTACTGGCGGTCGGTGTCGGGTGTCCAGGCATCCTCAAGGCACACGGTGTGATCCA
CGCAGCAGCCAACTTCCCCTCGTGGAGCGACGTGCCGCTGCGGCAGCTCTTCGTTGACCGCCTCGATGGGCTTCAGGTATGTTGTCACGTATGTAGCTAT
TCGCTTGTAGTGCACGTACAGACTTAGCTTCTATATATGGCTGGTGTGTATCATGAACAGGTCCACGTGTGCAACGACGCGGACGCCGCGATCCTGGCGG
AGCAGTGGGTCGGCACAGCCAAGGCGAGCGTGACAAACTTCATCATGCTCAGTATGGAGAAAACACATGCTGCTTGCGAGTGTGCGTATTTAAACGAGTG
GTGTGTATGTATGCAGCACTTGGGACAGGCGTGGGCGTCGGCATCATCAGCGACGGGAAGCTCGTGCGCGGCGGCTCGAACGCCATCGAAGGCGGCCACA
TGGTTCGTACACCAGTGCTATCCATGTGGCTTTCCATTGCACTCTAACTTAATGTGAGCTGCCAAGAGCGATCTGAATTTTATTAACTCTGGATGTGGGG
CGGTTGCAGATCGTGGAGCGCAATGGTCGGCTCTGCGGGTGCACTCAGCGCGGATGCCTCGAGGCTTACAGCTCAGCGGGGGCGCTCGTGCTCGAGGCGC
AAGAACACGTCACTGCGGGCGCGGACTCGGCGCTCGCAGCGTACACCTTGGAGGAAATCACAGCCAAGCTCATCTTTAAACTGGCTGTAAAGGGCGACGC
GATGTGCACGCGGCTTATCGCAGAGGTACATGAATTATATGTTTCACAATGTGTGGAGAAGAGTACTAATGTTGCTATGGATGGATGGCTGTGTCCTGCA
GGCTGCGGACTACTTGGGCTTGGCGTGCGTGACTTTTTGTCGAATGCTAGACCCGGAGGTCCGGACTCAAATGAAAATTGGTTTCATCTCTTGAAGTAAG
ATCTCTGACTATCAACGAACACTGTTATATTGTGAATGAATTAGATGATCGTGCTCTCTGGTGGGATGGCGGAGGCCGGTGACGTCTTCTTGCAACAAGT
CCGGGCTTCGTATTTCAAATACGCGTGGACCAAGTTCTCCAATCCAGTACGTCATTGTATTGCCTCTCCTATCGCTGTAGCTTCACGTGATCGCTGTGCT
GACAATTTTTGTGTTGTATTTGTTTGCTTACTCTGTGATCAAAGGTACAAATCGAGATCGCGAGTGCGGGGTACGATTCGGGGATCATCGGCGCTGCCGC
CTCGTGTCGTGCATACCTGCTGCTGTGAACAAGTACAATTGGCGAAGCCCGTGCAGAATTTGGTTCGTGGTGTTTATCACGATCACTCGTTTGCACATGA
ACAAACACACACAATGTATCGATTCACACTACGATCATATACAACTGCGCTAAATGGACTATACAATTTACTCAACTCTGACATGTATACCGTGTGCTCC
AGCTGCTGCGATTCGGTAACACTGTCCTGCATGCGTCACCATTAGTAACCCGCGCCGGTCTGCACCACATCGCTACCGGCGGCGGCGGTGGTACCGCTCG
GGTCGGACGCGCTGGTAGTGGTCGTAGCCGAAGCAGAGGCTCCACGTGGAGCAGCGCGGTCGGGGACCACAAAGCCAGCCTTCTTCAGATCGATACCATT
GACCTCGGCGTGAGGCGAGAAGCCCAGCTCCTTGAGCTCCATCTTGATGATCTCGACGCGCACAGGGTCGAGCGAGGCATCCGCAGCGATAGGAGTCGGC
GGAGACACCGGAGCTGGAGTCGGCGCCAGAGCTGGGGTGACGACAGGGACAGCGCTAGAGCCTAACTGCGAGAGGTCGACGCCGACCTCCTTAGCATACA
CAGAGTGGTCGACGAGCTTCATCTCGTCTTGCATCACCTTGACGCACTCAGGGCTGATGATCTCGCCAGACGACGGTGCCACCGGGGCTGAAATTGCTGC
GAGGTCGACGCCGGCCGCTTTGGCGTACGGAGAGTGGCCGAATCTCTTCTGCTGCTTCTGCATCATTTTGACGCGCGCCGGTCTGATGGCCTTGCCATAT
GATGATACGACTGGAGCCGCATTCTTCGAGTAGTACGCCATCTCTTCGCCGTGCACCTGAGGCGCGTGGAGAGCCGTGATCGCCGCAAGGGCCAAGGTGA
TGCACTTGATCGCAGTCGTGACTTGCATGATGAAGTTGGTGGTGGGGTGAAGTAGTGGTGGAGGTGGTACTTGCTGCTGGTTGACAAATTGAGTTGTGAG
GAAGGAAGTGCGGGTGGACTGCTGCCTGCCTCACTCGATGCGCTCTTCGCAAGCGTCCGTGGTCTGTTGATTGCCATTGGCGAGCTGAGTTGTCCAGGAT
ACAGATGACCATCTCGTATTGTGAAGAGGGTGCTCGCCCCACAAAGCCACCTCCTAGTGAACACTTGCGTCCACGAACCACGAATGCGACCTGGAAATCC
TGGATGGCCATCCCCTGCTCGGTATATTTGGTGAGCAGCAGATATGGTGGCGGCTGTCAGTATGGGGGTCACAGAAGCCCCCATTCACCACCACGTGGAC
CAACCGGTCGTGGTGAACATCATGCCTGCACCTATTCGATTACCAGGATCGACTGGTGGCTGGCACCACGTGGGACCGACGAAGAGGTCATCAAGGGTGG
ACCCTTTCGGAATCAACCCACTCGCCATTCGTAGCTCTTCCCAAGTCTTGAACAGATCACGAGGCATCAGAAGAGCAATGAAAGTGGCGTTCGTGGGCTG
CACGCATGGCGAGCTGGACTCGATCTACGCGCACATCGACGTGTACAACGCCACTGCAAGAACCACCATCGAGCGCATCCAGCTGCTCATCTGCTGCGGG
GACTTTGAGAGTCTGCGCAACAGCAACGACCTGCAGTGCAAGGTGTGTCCACCCAAGTACCGCCACATGAACGCCTTCCCGGCGTACTACACGGGCGAGA
AGCGCGCGAGTGTGCTCACGATCTTCATCGGCGGCAACCACGAGGCGTCCAACTACCTCCAGGAGCTCCACTACGGCGGCTGGGTGGCTCCCAAGATCTT
TTATCTGGGGGCTGCGGGCATCATTAACGTTGGTGGTCTGCGCTTCGCTGGGATCTAGGGGATTTACCAGGCCAAGCACTACCACAAGGGCCACTTTGAG
ACGGCGCCGTACAACAAGGACGCGGTCAAGAGCGTCTACTGCGTGCGCGAGTTTGAAATATACCAGCTCGCGCACTTGGCCGCCACGGGTGGCAAGCCCA
GGCGACAATTGGATGCGTTCCTGTCGCATGATTGACTCACGCACATTGAGGACCACGGTGGCGAGGCTGCGCTGCTCGGGCAGCGGCCAGACTTCAAGTT
CAGCATTGCGCTCGGTAGCTTTGGGAGCCCGGGCAGCGAGCATCTGCTCAAGACGCTGCGTCCAAGGGAGTGGCTCGTGGGCCACATGCATCTCCACTTT
GAAGTCCAAGTACAGCATGCCGGAGAGAAGATGCATTTCCTGGCGCTGAGCAAGTGCTTGCCTGGGAAAGCGTGCCTGGAAGTGCTCAAACTGCCGTCGG
CGCTTGATGAAGCCTTGCTGGAGAATGAAGACTGCGATGAAGGCGAAGAGCTCCGAGTGCTGATGGACGCAGAATGGCTCGCGATTCTCCGCGCCACGCA
CCATTTGACATCCAGCGCCAGGACACCCATTGTCCTCCCAACGGAGCACATGGACGTGGACGTCGAGTGGGTGGAGCAGCGATTCGACAAGGCCTTCAGC
AACTCTCCAGAACTGAAGAACAAGGTGCGAGGCGAGTGGCCGAGCGACTTTGTGATGACTGCGCCGCTGCTGGGCCAGGAGAGCGGCAGTGCGAGCGAAT
TCCGCATGGGAAACCCTCAGACAGACGCGCTCTTGGCGCTGCTCGAGCTGCCGCACGTTGTCACGGCTCCATTCGCCTTCATAGGCTGAGCTATGCTGTC
CATGTTATCAGATCGCACTTAGCGCTAAGTACGTATCTGAGGCAATCCATTACGTAATCATCACACGATTGTCTCAGATTGACAACTTCAGAGCTGTTGA
CAAGCATCACATCCCAATCGTCTCCACTCGACGCACCAAGCGGCCTCCTCCAGTCACGACACTCGCATACAGAGCAGCAGAGCATGAGCTTCACAGCCAA
CACCAATATCCGCGTGCTCTGTCTGCACGGCTACGCGCAGAACGGTGAGACGCTGCGCGGCCGCATCGCCGCATTCCGACGAGCGTTCAAGTCCAGCGTC
GACTTTGGTGCGCTCTTCTTGCTGCTTGTGTGTTAGTAGGGTTCATTGAATTCGTATGGCGTGTGCTCAGGTGTGTGAATATGGCAATGTGATAGTGTGC
GTCGACGCGCCCATCGTGATTCAGAAGGACCCGTTCACCCAGTCCAAGAACACCACGAGGTACACTATGTGTCCATATAAATCACCTTGTCGACTGCATG
TCGACTAGATGGCTCATCGTGGGTCTTGTGTGTCTTTGTAGCGAAACTGCTGCTGGCGATGATGCAGTCGCTCAGAGCGACACCACCCAAACGTTCCAGC
ACCAGCAGCTCTCGTGGTTTGGCTTCCACGTGGACGAGCTCTCGGGCAAAGTGACGCTCTCCCAGGTGGACGAGGCGATTGCGTACCTCGCCAAGGTCGT
GCGCGAGCAGGGCCCATTCGACGGCGTCTTTGGGTTCAGCCAGGGCGGAACCATCGCCTCGCTCGTCTTCCAGCACCAGCGTACGTACACTCATTGCTCT
TATAGGTGACTATTTACGCTCGCAGGTCTAGCTAACCACCGTTGGCGTTGCTCTATACGTGTGCATAAAACAACAGACGACAAGCCTGAAGACTGGACCT
CGACGTTCCACTTCGGCATTTTCGTGTCGGCGCCGCAGTCGCGCGACCCGAACGTTGGCAACGCGGACCTCAGCCTGGCGATCCCGACGCTCCATGTGAT
CGGAGAGACCGACGCCGTTGTCGCGCCCGAGAGCTCCAAGAGCCTCGCGGCTGGCTTTGTCGAGCCAAACGTGTTCTTGCACAGTGGAGGCCACTACATC
CCTACGAGCAAGGAGCCCAAGGACGTGTTCCGAGACTTTTTCAAGCAGCTCAAGGACGTGCTCCCAGCAAAGTAGATATAGTAGACGCACCTTCGATAAT
CAACCCCTGAGGTGATCGATTCATTCTTGCTCCCGTGCGTATGCGATCCTAACCTCGGAGATTGGCTGGCTGACAGTTGGGTGTGTGGTGGTGTGGTTCA
TCCGCCACAGTTTGCTGTCCCTCAGTGCAACAAATGTGACGGATGAATCAAACCACCCAGTAATCAGCTTCAAACTGGTCCTGCTTGGCCATTGCAGCAC
GGTCAATCTACCTCTCCGGTGAGGTGAAGCACGTCACAACAACGCAGGCTAGAATGCGGTGGTACTCGAGTACTTTGAGCTCCTAGTGTAGTCGATCAAC
GAGATTGAGCATGGTGATCGATAATTGCGAACAAGACGCTGCAAATCGTGCACTTCAGTCGAAAGCCAATGGAGCGTTAACTGGGCACGTCCACTTATGC
GCTGGCGCTTGGAGCGTTCTGACAGAGAGCTGCTGCCTGTCGGATTCTCGATGTAGGCTCGTCTGGCATTTCTGAGCGCTGGGGTTGTGCTATCGGACAC
AACATCGGTGTAGTCGCGAGTGGACTCGACCGTGTTCGCAATCATGGCGCAATTTGCGACGTCCTCAGTGCAGCGCGTTGTGTGATTCACGCCAGTTGGG
AGGTCGTTGAGAGTGTTTCGTGGGTAATGAACAACCAGCTGCAAGGTTGAAAGTCACTGCTGCTGGGACCAGCGATGAAACTGAAACAACGTAGCTATCG
TTTGCCAATAGAGCAATCCAGCAATTTCACATTACCTAGGTGGCAGCATTGCTTAGGTTGTCTCGACGTTGTCTGGCGGGTTCCTTTATGCAGCCCTATG
AGGGAGCCAATCGCATGCAAAACCTCAGTGACCACCACAGCCTCAGCACCATGGACAAAACGAGCCGAACCATTAACCATTATCACAATCGAGCTTTCGC
CACATTAGCACCATCTCTGAATCTCCCACACTACAGGTTTCCCGCCGTCCAAAATACCGTCGAGTTGGATCCGATGCTGCCGAGCATATGGCGTTGCGGG
TTCCACTGAAGATCCACCACTGGCCCCTGGTGGCCTCGTGGCAAAGTGTGGACGTGCTCACCATTGGACGTCCTGTAGACAAAGATGCGGCCGTCATCCG
AACCCGTGGTCACGTACGCACCGTCTGCAGAGTAAGCGCTTCCCAGTTTGATGTCGCCACGCTGGTTGCCGTCGTGCTTGGTGAACATGTGTAGCAAGTG
GCCCTCAAAGGCGTCCAGGTGCAGGAAGACGCCCCGGTTCGTGGTCACGAGCAGCTGGTTCCC