Description :
From Genome Similarity Track
Location :
Scaffold_57:184208- 185540
Sequence
1332 bases(100 bases per row)
CCATAGTGGCGTTGGACGGAACATACATCTCGGTTGCTCGAGTGTTAACAACTGAGGGAAATGAAGCAACGGAGGATACGAGAAATGATTTCTACGAACA
CCCAGCTAACAACATTGGCTTGGACGACTACGCGAAGGAGCTGGCATTCCTGCCGGATCTGACCGAAGAGATCAACACGACAAGTGACTACACTGCGCCT
AATGTTGCTGATCCTGAGATGTCCGACTGAACGCCGAGAACGTCTGGTCGCGACGCTAAAGAACCACGAGCACATCCCTGATTGCTAGTGGTAACGCACT
ACCGCCGCCAGCCTACGGAGCGGTATGCGATATACACAAGGGGCACGCCCCAATTAAACAGCGTGCCCGACGCGTGCCGCTGCGATTTCTCGGCAAGCTG
TACGAGCTGCTGCGCGCTTTATTGCGTGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCCGATCGTGATTGTGATGAAAAAGAACGGGCTGG
ACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAATATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTCGAGCG
CTACCTATGGTTCTGCTCGCTGGAAGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCGCGTAAAGTATCGGCGTTCGTCTGCGCACTCGGA
CATTTCGAGTGGTTACGCATGCCCTTCGGGCTAAAGAACGCGCCGATGATCTATCAGCGTATGATTGACAACGCACTCTGGGGGTTCGTTCAGCCTAAAG
GAGGTTGGTTTGAATACTCGGAGAAGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGGCCAAGCGCCGAGGGTTCGTTTCAAACGAAGTTCGC
GGCAGACCGCGTAGCACCGGTAGAAACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAGCCAGACGAATCATCG
CTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTAGCAA
GATTCGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAG
AGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGC
TTCATTCAAGACTTCGCGGTCTACGGTGCGGC