Description :
From Genome Similarity Track
Location :
Scaffold_216:18420- 33114
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.16DUF1168 domain protein
Pytul_var.sporangiiferummaker-pug3_contig_216-fgenesh-gene-0.350S ribosomal protein L13
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.17Flagellar protein
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.12Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.18Mitochondrial Carrier (MC) Family
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.13Cysteine protease family C01A
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.14Cysteine protease family C01A

Sequence
14694 bases(100 bases per row)
TGGTCTGTGAAGCAATTACGATGAAATAGGGTGAATATGCGCAAATGAGGACTCGTTTCATTCCTCATGCACGCTCTTTACTGTCTGTGGCACCACCGCG
TTCTAGCTTTCGGTAACTCGTGAGTTGCACATCATTACTACTACTGCTGCTGCTGCTGTTCCTGTTTTTTCTTCTGCTCAATGAGCATTCGTTCCAGAAA
GCTGCCGTCGTTCGGAATCTCAGGCACGCCGCCGGGGGTCTCTGGAAGCACTTCTGGTTGTGTATCCGCTGCTGCTGCCTTCTGTTTTTTCTGCTTGGGT
GCATCGGCATTTCCTTTAGATTCATCCTCGCTATCTCCATTATCATCATCCCCAGTCGAGAGCGACTTGGCTTTGGTGCGCTCCTTGCGGCGACGGCGTT
TCTCGGCGCGCTTGTGCGCACGCGCTTCGAACTCGCTCATGTTTTGTAGCCGCTTTTTCTCAAACTCTTCCTTGATTTTCCTTTGCTCGTACTCTTTTTC
CATGCGTTCGACACGCTCGAGTTCTCTGTTTTTATCCGAAATACACGCAACACACAGTTTATGACAATTCTATCCCGTTTTAATAATACTCAATACATCA
TTTTTGTACGCAAAGCGCGGACACATAGAAACACATACCGTCGACGCGCCGCACGATACATGTGGAAGTCGCCACTTCCAGCGCCAGCAGAACTCCCCGA
TACGTTTTCGACGCGGTTGATGCTCACTTTCGCGCTCTGGTGCTTGTCTCCACCGCTGCTGCTGGCATCACCAGCGCCCTGCGTGGCGCCATCGCCNNNN
NNNNNNNNNNNNNNNNNNNNNNGTAGTGACTCACGCCCGAGCTCGCTGCTGCTGTTGCCGTCGCGGATGAATACGAGATGGCGGCCTTCGCATCCTGGTC
CGTAAACGTCTGCACCGTCGTGTAGCGCCCCATTCTCTTGTTCGAGGCTCTCTTGTTTTGCTTGGAAGCACCAAAAAGCTCTGTGCAAGTGTATGAACCT
CGAAACCTTATAATCGATTCCGTGTGGCACAGAAAGACTGTGTCATAGAGAAGTAATGTTTTGTGGTAGTCAAATACTAAACGAATAGTTTCTTTGCGTT
AATATATCCTGGCATGACCTACTCCACCGGGTGGTTACATCAAATTAGACAGTAGTGAAAGTCACCCAGCAGGAAAATATCGGTATGTGTACCGGTTTGC
CACACGCATTATTGGTTGGTTTGGATTCCCCATTTTGGTGCCAACACTCAAGCACAAAGCGCAGCAGAAGCCAGCAGCTCGTCTCTGTGTGTGATCAGCA
GCAGCAGCCATGAGCAAGATCGCGAACGCCTCCAAGGTGGCGTGGCACGTCGTGGACGCCAAGGGTCAGGTACTCGGCCGCTTGGCCTCGCAGCTCGCGC
CGATCTTGCGTGGCAAGCACAAGCCCACGTTCGCGCCCAACGTCGACTGTGGCGACTACGTGGTCGTGATCAACGCCAAGGATATTGTGCTCACTGGGAA
CAAATGGAACAATAAATTATATCGCTGGCACACGGGCCACCCAGGCGGCTTGAAGCAGCGCTCGGCCAAGGAGCTTTTCGAGCGCAAGCCCGAGGAAGTG
CTGCGCAAGGCCGTGTTCGGTATGTTGCCGAAGAACCGCATGCGCGCGCTGCAGGACAAGAAGCTCAAGATCTTCATGGACGAGCACCATGACTTCGTCG
AGCAGGTCGGCGAGAACCCAACGATTCTATAGNNNNNNNNNNNNNNNNNNNNNGACGAGGCGAGAAGTGAGAACGGTGTGTGTGCGCGCCCGATGCACAA
GCGGCAGAGGAAGAGCGAAAAGAGGCGCATAACAAGTCGAAATACACGCAAAAAAACTGTTACCTACATGTGCTGTTTTTTAATGGATCTCTATGTGTCT
ACAGCTTCGCTATCGCTCGATTCAGTTGCTTCTGCTTGATCTACATGGTCGAGTGCTACTTGTTCGTCCAACAGCAGTTGCATGGAATCTTCGTCGTCGC
TCAAAACAGTGAGGAACGCGTCAACACTGACAAGGCCTGTGGCTGGATCCATGAATCGACTACCAATCTACAATTTCACAGCAATGCGCATGCATCATGA
GTCCAAAACGCAACACGCTCCTGTAATTCTCTCTCCCTATCGACTTACCTTTGCGAACAGATGAGACGGGCAGCCTCGCAGCAATCTCGGGAGCAATGGC
GTGGAGCTCAAACTGGTCATGATGTCCACCAACACAAACAACGGCACACGGTCGTCGCCATCCACGGTTGTGCCCGATGCTAACACTTTTCTGACTTCCT
GAACCTGACGAGGGTTCAAGAGAATATCATGTCGCTCTTCAACGATCGGCGGCGGGTCCACTGCTGGTGGTGGAACTAAACGAGTCGTGGAATCAACGAT
CACGAACGTATCGTCTCGAAGCTGAATGGTGATTGGGAACCGATACAGCAATTCAGGCTGCTCACATATACATAATTGGGCAGACATAAAAGAGTAAGAG
AATGCAGGCGCTCCCACACTTCAGCAACGCAAACCCATTTCTACATACCTTGACATTGATAAAGTACGGAAGGCTCACTTCGGCTTCGATCGCCGCTCGA
ATATACTTGATCAAGGCCGAGGTCGCGGCGTTTTCTCGCTGCTTCCGCTCGTCAATGACGTCCCGCAACGTCATCTCAACGGATCGCATGGACTTCGACA
CTTGATCACATGCTGACTGCATGGCGTCTCGAAGAAAGCGGATGCGGCGCTGCATGAGCTCGTGCTCGTACTGAATGCCCCTCACCAGATTTGTGACGCA
AGGATCTGCTGACGGGACATTGACGAGTTTATTCGACGATGAAGGGTTCAAAGTGTCCGTCTTGTGGCGATCCGCACTCCCGTTATCAACCTTCGAAAGT
ACGAGATGAGCCAGTGCATCACACTTTTGCAACGCTTTCTCGTACGACACCAAAAGCTCGTCCATCGACATCGGATCGCCACTTTCTTTTGCTAGATCGT
GTACGCTTGAAGCATGCACAGGTGCTGCTGGCGCCGGAGCAGCCGCTTTGCCTTTACCTTTCCCAGCCGCAGCTTTCCCAGCCGGGGCAGCAGGCGTAGC
TGCAGCGACGACAGGAGCAACAGCGGCGGCTTCTTCAGTTGCGGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACAGGTCAAGC
AGTGCTGGATTTGCTTTCAGATTATCCGCTGCTGCAGCAGTACTTGACGGCATCATGCTTGCTGCAGCGAATCCATCAATGAGCAATTGGACGGAGATGA
GGAAACGGTCGCACTCAGATTGTAACGCCACCTGGAAAATGATTGCGACGCACTGGCACGTGTCTTCAATCCACCCATCCGTCATGACTCCGTTCAGTTC
ATCCTCGTTCTCTGTGGTTTTTGCCTCGACAATGTCCATCAGCTCGTCCTGCAGGATATCGGTTCGCGCATGCAACTCGAGCTTGGTGGCTTCGTCAAAC
CGCATTTCATCGACCACTTGATTAAACAATTCCTGAAATTGGTTCACATGGCTTTGCTTCGCATCAGGACGCCGCAGAAACTGGCAAAATTGGTCAATGA
TGCGACTGGCGCGATCTGATGTACGCTTTCGCTGCTCTCGCTGCAGATCAAATGCCTTCGTCATCATCGACACGTACTCGTGCTCCATGTCGTCCCACGC
ACCGGCCAGCACCGAGCTCAGTTGCGGAAGTAGCCGACCAGAAAACTTTTCTGCATTCTTCTTCGCACGCGCACGCTCCTGCCGAATCGATACCACGGCA
GTGTTGGTAGCAGCATCGATATGTTTCTGGGCTATATCCAAAGTATGTCGGAGTTCTGCGAGCTCTTCCTTTTTCGCTTTGGATTCTTCTGCTTGATGAA
GCGCATGCTGACAACGACTATGCTCTTCCTCGGCAGCATGGATGGCATGTTCTAGCTCATGTATTCGCAATTGATGTAGCTCCTCGGTTCTCATCAGCTC
TAGTTCGGCATCCTCTTGGTCTTGCTGTCGCGATTGAGCAATATTATCTTGGTCTTTATAGAATTGATCCACGAAGCCAGCCATTTGCTCATGGATCTCA
TCGACACTCGAGTCTGCTGTCGACACTTCTCTCAACGTATCGAACTTTTTGTACCATGGCTTTTGCAATTGTGCGAATTCGTCGCTTGTAACATACTGAA
GCGACAAGAGTTCACTACAGTTGACGCTCGGGTTCGTACGACTGAGGCGATGGCGCTCTGTCGAATCTTCAGGCGGTTCGTTGTACACCAGATGGAACTT
TTCATGCGTTGCTTCGTCTTCGACTTGCCCCAGACACCTCTCCATTGCAGTTTCACAAGTGCAGTTCAAGTAAAACACCAAATCGACACCGGATTTTCCA
TGCAAGAAAGTCGATGGCAGCTTTGGCTTCACGCAGCCTGGGGCAATGAGAGACTCAAGCTCAAAAGGCGACGGAATCAATTCCGGATCAACAAAACCTG
TGAGCAATTCTTCCAAATTCCGCGCCTGCGCCTCTGTACTGGGCAGGTCATACACAATCCACCCTTTTCTTCCAGACTGTCCACCCGCAGGTGACGTATC
TGGCGAACTCATCAACGTTCGTACTGCATCAAAGACAAGCCGGCTGTATATCCGTGGTAGAATCTCACTACCACTTGAAAGCAATTGCTGAATTTCCAGT
CCGATCTCACTCTGTCCCTGAACAGCATCTTCGACGAGCTGATGCACAGAGATCAAAGCGAGCTCGTACTTCTCCGCAAGTCGCATTGCTTGGAGTTTCT
TTCCAGCGAAAGGTGACCCAAATACCAGGATTCGAAGCAATCGTGGCGGAGGCTCAGCAGATTTTACCTGTGGTACTGCCTCGACTGCTGATGTATCTTC
GAGTTCGGGGAGCGTATCCTGCTGAAAATCATCATTGACAACTGTTGGCTCCATTGCTGGATTATCTGATGGCTCCGACGAAGTCGAACGCTCTGGCTGA
TCTTCAGTTGCAGTGGCCTCTGGTGACCCACCACTGCTGCCAGTGCTTGATGTGATGGTCTGGCGAATCCATCGTATGTACTTCACTTCTTCACCAAGAA
CATATCGATCTTCGAGAACCTCCACAGCACCGATGAACAGCGTATCCCGCGGGCACCACGGTGACAGCACAGTTCCTTTCGCAGATGAGCCGACATAGTC
CATTGTGATGTGCGGAAGTGGGAGGAAATTTGCCAGGTACTGATCCAATTGGAAATGGCTGAGCAGTTGGTCACTATTTGTCTGTACATCACTAGGCACA
ACATCCTCACCGAGCAGTGGGTGACCGTACGCAAACTGCACTTTGTACTCTGTCCACGTTTCTTGTGGCACGAAAATGGTCGGGCTTCGAGCATACAGCG
TCTCCTCGCGCTTCCCGGCGACAAACAACGTAAAATCCACCAGATCCTGCATAATGCTCGCGGCAATGAGCTCGTTCAAGTGCCGCTGAGAAGCACTAGT
GGCAACTTGAAAGTGATGCTTCTGCATGATCTGCATCTCCCCATCGTCGTTGTAGCGCAATAGCAGCCGACCATAGATACTTGCATCCCGCTCGATTGCT
GCTGCGCTATCAGCTTCTCGCTGCTTAATGTACTCTGCACACCGCAATTCTCGATTTTCACGAGCAATTTCCTTGAACACGAGCACGTCATCGATACCTT
TCCGGGAGTCTTTTTCACTGTTTGTTTCGCGTGCCACGAGCATGTCAAGCGTTGTACTCGCTCGCGCACTGCTGAGCTGTGCATGGTACTTGCCGCAATC
CTGTACAAATCGCTTTCGTCGCCTTTCCAGTTGTTCCTTGCGTTTGTTTCGTTGCTGCTTTTGCTCCTGTATAAAATTGAGATCCTGCACCAAATCTGCC
CTGTCCATCGGCCGCTCTGTCGCCTGCCGCGATGCTGGAGAGAGGAGGGAAGCAATGGTCTTTGAGTCTGCCTTTTCCAGCGTCGTACTAAGTGATCGGA
GCCCGTAGCCAGCAGATTTTCGTGACGGAAAGCTTGCATCTTTAGACGCAGACTTTGCACCTCCTCGTCGATTCTACTCATACAGAGTTGGCACCATTAG
CCGTGATAAGATATACCTGAATACACGCGGACGCAATTACCCAGAAGATTCACGNNNNNNNNNNNNNNNNNNNNNNNNNCCTCAAATTCATCGAGATCAG
CTTTCACTGTCTGCCGTAAGCTGAATGTATGCTCTTCCTACAGAACGTACAATGACCGCGCCGACATCAGTGAGGCAAGACTCGCACAAGCATCGCGGCA
TCCATCCTTCAGCACTCATAACACCATTCTCGTTGGCGTACCTGCTGTTTGGCGCGATGGGCGAGCAATTGCTGATAGAAAACCGCTTTCCGGTGCTCTC
TTGCGTTCTTTTTCTCGAGTGCGATGCGCCACGCGGGCGAATTCGTTTCCTCTAAGGCTACTTTGATAAAATGGCTATGGATGAACGCCTTGTGGAGCCG
CTCTGCCTTGGTGATCTCGAGCTGGTCGCGGATCTCTGCCTGGCGGCGGAGATACGCATGCCGCTTTTTCTCTTCATCGGCAATTTCATCTCTACAAAGC
AAAAAAAACGCCGAAACACAGGTCATCATGACGCAGAAACATCCCCACATTTGAATGTGGAGGACAACGGTACGTACTTTTCGCGCTTGAGCGTGGCGAG
CGACTTCACATGGCGTCGGATCGAGTACTCGAAGGACGCGTGGTTGCCTGCATCGTACGTGGGCTTCGCGAGCGTCGTTGGCATGTTGTGCAGCGAGAGG
ATCGCATTCCGTTCGAGTGATTTCGTGGACACCTCCGGCGCGCGTCGGATCCGCTCAGCTGTCATCTGCCATACACACATACATACATGAGCACAAATGT
CCTTGAAACGCGCATCACAGTCTATCACGTCGATACCTTGATCTGATAGAGCAAGTTCGCAGCAGCGCCCTTTTTGCCGTTCATGATCGCCGTGGCGAGC
GTCGCGTCGAGCCGCACGCCCATGTTACGCAATGACGGCTCAAGTAGACAAAAGTTGATGATCTTGGCGTCGGCGATGTTGCTGTTCATGAAATCCGCAA
AGTTGTGCTGCTGATTCAGGTGGAAGAGGATCTCGCCGAGAAGATAGCCGCTCGCAAAGTCGCACTCCAGGTCCGTCACGTACGTCGAGAGCTGCAGGTC
ATGGTTGAGCCACGCGAGCAGCAGCTCCGACATCCTGAGCGTGTGTATGTGTATCTGTACTATGCGTATGTCGCAACGTCACCACCTGCAGAGCCGATCG
GTCGCGGCTCTTTGGACGAGAGGCATGAGGTTTGGTCCCCATTTTAGAACGCACCACGCTTCCACATCTAGGCGCGAACCGACACATTTGCAACCAAACA
CAAGTTACTCTATGCGAGATATGTATGCGGACACACATGCTACTTTGGACGAAAGAAATATAAATGCGTTGTGCCTATCCAGTGTGCCAGATGGCGTTTA
GGACTGTTCCAAGTGACAGCTGCGCGTGATAAATTACCGAATCTGAATTATGAAAACTTTCTGCACTTCTTGTAGTTTACTTGCTGAAGTGATGAAAGTA
AATTAACTGAGCTGCACTGACGATACGCGCTGGTAAGTGGCCAAAAAAGGTTCCGTTTTTTTACATAATTATAACTCATCGTCCTCACTTTTTATCCGTA
AAAAGGGAGAGGGCAGTACACTTTAAAGTATGGAATACAGAAGGACGAGAAAGCGAGAGGGTTCAAAGAAGAATTGAAGCGCATCCTAGATGCATTCACG
CCAGACGCCAGACTCATACACCCACGCCAGACACTAGACTTATACACCCACTCGCTGGCCATGCGCGGATTACTGTTACAATTGTCGCACTCGAGGTTCT
TGTCTCTCTTTTTTTAAGTTTTGTCAGTGCGATCACATAAATTATGCGCGTCATGGTCCGTTGTGTTGGACATTGAAACGGGATTGCGCCAGAATTATAA
TACATTACAATTCGTGTTTTGTTCCTTGCATTTCGCCAACATGGTCTCAGAATGAATAACTGGCGCAACCAGCCATGCTGGATGGAGAGAGATTACGACA
ACAAATAATAACTTCCGCGTCATTTAAAGCGCGTGTGATTGGTCGCGCTAGCATAACCTAACGAAACGAGCAGATGTCGCGCAGACTCAACCCTAATACT
CATCATTATCAGCGGCTGAAGTTTCCAAATGGAGGGGCTCTGTCACATCCAGTAAGACGCTTGCACTGAAGTTGCTGAATGCGAAGGTGCGTTTTTTCGA
AACGGTCGATTCGCCCCACCCCAGAAGTAGGTGCAATTCACCCAAATGACACAGTAGACTCATTATCTGATCTACTACCGTGTTTTGGTTCGTAATTTAT
CGACTAAAAATTACGGCTCTTCAAGATGTTCAGTCATGGCCAAAGTGCTGTTGCGTCTTCCGGACGATCTTCTCTTGATTCCTCCTGCCCTCTCAACGCG
ACGCATAGCGCATATTTGAACTCGTTACGCGCACTCATTTTGATACGTTGCGGCGGAGGCGTAAACGCGGGTGTTTGGGATCACTGCGCATTTCCGAGAC
ACCAATCACAGCAGCGCTGCTGTTGACGCCCAACACTTCCAAGCGATAACAAACAGAGAGGACGAAAACACGTGCGTGTCCACGCTCCATCCACTATTCG
TTCGGTTATTTATCGTGCGTAAATTACCAAAGCAGACAAGACAAGGAAACCAAACGCCAGTCTGTCAGCTGCTCTTGCCTCGCCGCATGCGGCAAATAAT
AGCGAACGAAGCATAATTAGCGGCGAGTCTGAGCATTTCCGAAATTGAAGATGAGTGCGTTCGTGCGAGAATGGCACGAGGAGACCGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCGGGCGCCGCGAGGAAGAAGAAAGTGCCGCCGGAGCTCAAGCCCGAGGACGATCACACGGAGGACGACGAAGAGGTC
GATGAGACGTTTCTCGCACTCCAAAAACTCCTGATGAACATGGAAGGCCGACGCCTGAGTCAAGTGGCGCCCACTGCAGCGACTGCGGCGAATGCGACGA
CCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTCGAATCGCGGCGGCGCGAGCGCGAACA
TTTCCGCCACTTGCTGTTTACCAAGAGCTCGACGGCGGCCGAGAATGCGGCGACGAATGATNNNNNNNNNNCCGGTGCCCGACCGCGGAAGACGATGACG
ACGACGAAGACGAAGCGCCGTCAGTGGAGAGCGCAATCACGAATCGCATGATGAACGGCTCGTTCTCGTCCTCGTTTTCCCGGTATAGCGTCCACGCGGT
CTCGCGTGACCGATGGGCAAAGGAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCAACCCCAAGCTCAACGTGACGCACACGGCCGAGTACATTGACCTGAGTGAACAAATGGAGGCCAAGCTCAAGAACGAGTCGAAGGACA
GGGGCCATGCGAGCTTGACGCCGCCGCGATCCACGTGGACCATACAGATGCGCGACTTTGAGGCGCTCACCGGCTAATGAACGTCAAGGCCGAACTGTGT
CCAGTGTTCATATGAAGGAAGCCCGTCATCGTGTAGTCGCCATCGTCATCTGTGCATAAGAGTATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATGGCCGTCATTTGGGAACGCCCAAGAAGAGAAAGAAAAAAGAAAGGAAGCATTGCCAGAGTTTACGATCGCCTGTTGTCATTCGTCCGCT
TTATTACTAGAAGTCACCCCGTGTACTACCAATATTTAAGTATTTGCATTGGAAAAATGACTGCGTTTCTTCTTCTCTCTCTATTGCTTTGCAAGATGAT
CCCATGATAATAACCAAGCATGAAGTGCGTTTGCTTTTTCTTCTCGATATGAACACTAGTTTATTTATTTTTTTGCTTTGGTGCTATCGCTACTCCCGCG
GCAGGAAGGCGGCGCGGTACTTCTCGTACGTGACGAAGAAGATGATGCACCAGGGCGCCTTGCGCATCCAGTTGGGCACGAAGCCCTTGTAGAACGCCTG
CACGCCGCCCTCCTGGAACGTCTGCCGGGCGCAGTCCGCCATGCCTGAGTACATCGAGCCCTTGCCCTTGGCGTCCGTCGCTTGGCTCATGAGCCGCGTC
TTGATCACGTCGATCGGGTTCGATGCTGCGGCGCCCGCGAAGCCCGCAACGAAACTCGCGCCCGTGTGCGCAAACACGCCTTCGCGCACGAGCCCTGACG
TGATGAGCCACTCTTTGCTGTGATCGTACGTGCCCAGCTCGGCCGCANNNNNNNNNNNNNNNNNTGAAGCCGCGCTGAATGTTCGGTGGCATGCCCTATC
GAGACGTAATGGATGTGCTGTTAGGATGAGCGGCTGCTGCATTATTATCCCCATAATTTTCATACTCTCAATGGAGCCAAAGCGTACCCGTAAGAAGCCG
CGGAAGCCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACGCCACGGTACAACGCACCGGTTCGATCCGCC
TGCATGCGTACTTTAATGACATCCACTCTGGAAGTAGACAATAAAGTAGCCATAGAATCAGATCAGATGTCCATGCGACCATCAAAGAGAAAGAGCAAAA
TGACGACGAGGGCGGCGACATGACAACACCCCATAGTCGCACACAATGCAACACATGCAGCAAAAATGCAACGTACGGGTTTGCAAGACTGATGCCGATG
GCGCCGGCAAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAA
GAAATCGCGCAGCGGCTCGTAGAGCACCATGCAGATGCTCGTGTACGACACTTGCCGCAGTAGCGCGGGCGTCGCCCCCTTCCAGAGCGCCCCCGGTCCT
TCTTCCTTCACAATCTTCTGCACAGCGTCCACCATACCCGTATACTGCACGTCTTTGCTTACTGCTGCCGTCACTACGCCAACGTTCGTGAGCACGGGCA
TCGACACGGCACGCTGCGCTTGGAGCCGCACTTTCGTGCAGTCGATCGGCAGCGTGAAGATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGCTCCTCCTGCACCAGCACTGCTCCATTCTTCGTCGC
CGTCGCTGTCGCCATGTTTCTTTATAGGATGCGATTTGGTAAATGAACGCGTTCAGCCGCACCAACGAATGAATCTGGCAGGCGATTTAATGGGCGCCAA
ATGCCGTTTGCGACAATACGAATGAGCAAGTTGTCGCCTGATGTCGTCGCTTTGGCGGTGAATGTCGTGACCGCCAGTCAGNNNNNNNNNNNNNNNNNNN
NNNNNNNGACGGTTGCCTGGTGCTTGGACGCGGACTGGCCAAATGGAACGAAACACCAGCTTTTTCTTCCCACCTGGCGCCGGCACGCGTGAATCTTCTG
GACGGTCCAGCAGCTGGGGCCTGAACGAGAAGTGAGCGTTCGGTCCGTTTCTATTAAGTGGTGCTTGAGCCTGGCGGTCGAGACAGAGCAGCAGCAAACG
CAATCCGAGATGGGATGCGCTCAGTCCAAAGGAGCTGCGTCTTCCAAGGATTTTCCTTTGGGGTCACAGTCAGAAGATGGCTCCGTTATGAGGTGCCGCT
CCCTCCTTTGATCACACAGAAGGCTGCATTTAGTTTTAATGTTATGTATAATGGTATGAAGATTTGTTCAGTCTGTTTTTGAAATGAAGCATACTATTTT
TTGCTGAAATATTATATACTGAAGGTAAAAGAGGGGGTTATCAGCAAGTTGGCAGCATACAAACTTCAAGTGCAAAGCTATGAAGCAGCGGAAATCGAAA
AACCCTTTGGTCAAAGACGGCTCCGATCCCATCCCATGATAATTCAGGTCACATGCATTCAGAATGATGCGATCCTCCAAGATGGGACATTCGCACGATG
ACGAGACTGGTGAGGGACACCTCCAAGAGATGGATGAGATTCAAGCCCGTGACGCGCAATGGCGATCGAATGAGCAGGAGCGTGGTTTGTGTGGGGAATT
GTATGCCCAAACACTCCAGCAAGCAAAAGTGGGACTTGAGATTATGTGACCGCAACTTCAATGCGCGATGGGTCAAGCCAGAGTTGTTTTTTTTATCTAG
GGGCTGGCTGACCAGCATGCACTTGCTTTTTCGGCGGCATGTGGATGCTGAGCAGACAACTTGCTCATGGAGGCTGGTACACTTCAGGAAAAACCAGCGT
CTAAAACATGGCGAAGCGAATCTTTCTTTTACTAATGGGAGCCGCAATTTGGCGGCTGTGAACGACATGTGCCTCTTGCCTATAATAAGCTCTGCTGTCA
TTTGCTCAAGGCTCACAAGGAGGCTTGCGAAGAGCCTCGGTCCAAACGTACCCTTTCGTTGTGTTCATTTTCGTTTCACCGTTATTTACTGTTGCACTCC
TTGCTCAATTGCAGCCTTGTGTATTTGTAGTGATGTGTTAAGACGTGGCTTACCAAGCAACTGATTCCCATGCATTTGCACCCTCACACAAGGCACAATG
AGTATCACGCACAAACGATTGCAATGCAGCCACGTGCATGACGGCTCTGATATGGACACGCTTCTGAACTACGCACCTCAATTTGCGCGTGAATACACAA
AAGTACACATTCACGAATAGCGAGAGGGGGTGGTGGCTGTGCCTGGTATCGTTTGAGCGTGCGAGGCGTGGGATGTGAGGCGGGCGATATGGCATGCACT
ACTGGGTTGCTGCTGGCTGTGGATTTATTTGCACATGCGCCTGTGGAAGTAAGTTGGTGAACAAACAGACATCTTCCCAGGCGATCATCACCTTGTAAAG
GATTTCCATTGAGCCTATAAGAGCAACATAACACCACCTCGTTCTTTTATGAACCCAGTTGGCATCTGGTGGGTGCGCAAGTGGATATTATTTCTTATCG
CGGATCACAAGTGCCGACATTATTAGATGCCGCTACATCCGCATCAAAGTGCATTTTCGCAACCTTTGTACATGTTAAAATCATATCTCATGCACATATT
CCGTTGAGCACCTGCAATGAAAAATTTCAAGAGGCGAAATCGACACCCTATTTCGCGTTTACAATCTTGGAACATCTTATCTTTTTTTTTCTCGCAGTCG
ATTCACAAGGATAAAAAGTGATGGCAATGTGCTTCGAGCATCAATATGCAAGTACTTCAGTATATGCGAATAGAGAGACTTTGCGTGAACTATAATTTAC
TTTGTTCTCAAGTGACACGTATCCAATTACAGCGATTATGCAATTACTCAAAATAAATAAAACACATGTTTAAAACAGAGATCGGCAGGATTATAATTTG
ACCGGATTTTTGAGCGAGCGTGCGACTCAAAAAAGCACATGGACTTCGACATAAATAGCGTTCTCTTGCGACCGCTGAATTACGCCCAACGAGAAGGTGT
AATAATCAAAATTTACGCCACGATGAGAGCGACTCGCGCGGCGCTCGGATGCCTTCTCCTCAGTGGTGGCGCCTGCGTAGCGGCGACCGCAGAAACCCAC
TCGATGGGGACGCTCGTGAGCTGTCCGGCAGACCGCGCCGCACCGTGTTTGTGGGCGGGTGAGAATGGCCAGGTGATCGACGCGCACGCGCTGCGCAGCC
GCATGCTCGCGACGAATTCGGTAGGTGGCCTGGACACAGAGACTGCCGCGCGCAACCTGGAGCGACACATGACGTATCTAGAGAGTAAGTGAGCCGCGAT
TAAAGAAAGTGTGTCCATTCAGTGGGACGAGAGGTGGACTCACACTGACATGTTGTGCTGCGGATGAATGAATAGATGTTCACAGGTACGCTCGCAGTGT
GGGCCACGAGTTCTCATACAAGATGGGGGTCCACGAACGTCACTTGTCGGATTCGAGCAAGCGCTCAAAACTGCCGGAAATGTTTGTGCACCAGGAAATG
CGTGCGGCGAAAGCAGCAGCGATGCGTCGTCGCCTGATGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCGACGATGAGCAGCTCGTCGAG
CAGCACGAGCACGAGCACAAGCGAATTCAACTGGTGCAACACAAAGAACCCAAAGGGACGCAGCGTATGCTCGGCGGTCAAGAGTCAGCAGAATTGTGGC
AGCTGCTGGGCGTTTGCCGCGGCGGATGCCATCGAGACGGCTGTCGCCATCGCCGCCAATCAAACAACTGCGGTTGCGCTCTCGCCGCAGCAGTTCCTAT
CGTGTAGCACTCGAGAAACTGAACAGACCTTTGAATATTGCTGGGCGACAAGCGGTGTGAGCGGCGTCACGTGGCTGAGCGACTCGATCAAATGGAAATC
CACGAACAACGGCTGCGACGGCGGCATGACGCATGGCGCGTTCATGGATGCAGCGCAATTGCAGTACGGTCTCGTGACGGAGCTGGAGATGCCG