Description :
From Genome Similarity Track
Location :
Scaffold_154:18420- 30375
Transcript NameFunction/comments
Phymu_g5647hypothetical protein
Phymu_g5648hypothetical protein PHYSODRAFT_552331
Phymu_g5649hypothetical protein

Sequence
11955 bases(100 bases per row)
GCACCGCAATAATGCCTATAAATACAAACCACGCTTCGCAACCGCCGACACATCAGCCGTGACGTCCTTCCTGCGGaaatgaagcagcagcactatGGCC
AGGCTCAGATCTTGCGCGACAGCGTCCCCGTCGTGGACCTAGAAAGGGAACAACGCACGAGTCGGTCCTGGTTGTGGGTCTGCTCGGGCCTCGTAAGCCG
AGACAAAGGCGAATGCTGTTTGAGCGTGGTGGAGACTGTATTcgtggacaagcagcagatctggTCCTGGTACTTCACAGACAAAGGCGCCGTACGCCGA
AAACCCCAAAACAGACTCACAGCGGAGCAAGTGCATCGCGCTTTTGTGCAGTTTGCGGACGCTGCGTTGGACCCGACGCGGCCAATTGCGGTGTGCTGGT
TCGACAAAAATGACACTCCAGGTGCCGTTCCGTTCCTGACTGCATCCGAATGCTTGACCTTCCTGCAGTCTGtatcgtccagcagtgcttGTAGCGCTGC
TATCAGTACGTTCGTTCGACCACGAGGCGAATTGGATGCCACTTGTTATGCCAACCTCGAGCACGAGTTCACGTACGTACGTGTGATCCAATTAGCCGGG
GCTAAAACTTGATTGATCCTGACGCTTGTACGTTGTAAATTAGGCTTCAGAAAAGCGGTCGGGTGCAGGGGAAAGTGTTCTGGTTGGCGCTTGGAGGGCA
GCGAATTACGAGCAAAGACGTCAAATTGAACGCTGTCGTGAACGAATTGGTGCAGCAATTGGTAAATTttctcgagaagaacaagaagtGTCGAGTAGCT
CGCTGTGTTTCTCTATTCGTAATGGAAGATAGTGGGAAACTCCAGTTGTGGCGGACATCCGCGTGCGAAACGATCTCCGCAGCAGTGACTCTGCCTTCCG
CTCCGACGTTCCCAGAAGCGTTAGTATCAACGTTTTCCAGTTCGTATGAAGGTCCTCGTGCCATGAATGAAAGACTCCTAGCTCGTGCCCGAGCTGAAGG
ATCCCGTGCACCCGACGAGCGATTAGTGGAAGCGATCATGGCGGCTCCAACGCTCCAATACAACAGGATGTTAACTCGCGTACCCGCTCTTTCAACGCGC
TTGGATCCTCTCGGAGAACTAGAGGGTCGACGCCGAGCAAACCTTGAATCGAGTGACTGGGATGAAGCTTTGTCCTTCCTTCCAGCtacgtcgtcgctgt
ctagaggacgaagacgcactGTGTCAGCGGCTCATCTAATGTCAAGCCAGAAACGCGGTTGTTGCGGGGATTTCTGCAGTTTGTCCATTGCCGAGTTGAC
TTCTAGACGAATGGAACGTAAGAAGGAGCCCACACTACTTGATCAGGCTGGACAAGCTAGAAAAGGGCGACGACGGACGAGTGTCGCTAATGCTACAGCC
ACAGCAAACGCCTTCATTGACGCGCATCGCACAGACGATTTACTTGGACGTTTGGCTCAGCATCGCAAACCTTCTTCTCCCCAAAGACTACAACGTGCTG
AAACTCGACAGCCTCCGCCACTGACGCATACGATCCCGTTCAAACTGGTGGCACAAACTCGagccgagaagcagcttgtggaTCTCTTTATTCGACGGTA
TCAAAGCGGTGAAGACGGTGATTACCTTGCAGAAGCATATTACGGAGACGGCGAGCCACTTGGAGTTACGTTCCCTGGTTATTACTATCGAGACGTGCAG
GTTTGTGCCAACTGCTACGAGTTCTACatgctggtggagaaagTTCGCATGAAAGCTCTGAATCAAGTCGCGCGTCGTGACAAAAGCCCAAGTCCTAATA
AACGTCGGATACAGCAAGTTCCAATCACTGAGAGAcgagaggaagaggacgaggaagaagataTCGATAACAACAAGCAGGTCGACGAATTGGATTACGT
CTGGAAACACATTTGGGCTCAAACTTccgctgtggctgcagctaTCACCAAGAaagacgctgcagagctctACAGTTTTGTCAGTCCTCATCCGGCTGTG
GAAATGGTACTGAGTGGCTTGGGAGCTTTACTTTTGGGATCACGAGGTGGAGACTGGGGAGAAGTCAAGCGCGCTATCTCGCAGGATAAATTACTGACTC
GCTTGCACCGTGTGGACTTGGAGGCTCTTTCAGAACGTGCTGTGatgcaagctgcagcgcatgctCGCAACCCGCTCTTCACTCCGGCACAGATCGCGCC
AATTAGTTCGTGCGCCGCGCGATTCTGTGATTGGATCCGCACTGTGTTGCAGGCTTATGCATGGAAACGGAGGCTTGAAATGCAAGACTTGGAGACACGA
CGTATGCTCTGCTTCCTCAAGCCAGAAATCTTGCCTGTCGGTGTTGCTACTAGCCAATTGGAAGATGTTCAACGTGACAAAATGACTTTGAAAAGGTCAA
GGATAAATGACCCAAGTAACGATGATTCTCTATCCAAAACACGACGTCAGGGTCAGCAGAAACAAGCCGCTCGTCGTGCGGTTCAAGCGCAGCAAATGTC
ACGTCTGGCGGCTCCGTCAGGGCTTCAAGACGGCGTGGGAAGCACCGCagacagcgtcttcacctGTCAGGATGGCGTCACGCAGATACCTTACGCCGTC
GTTGGACAGCCCATCGGTGAGACTGTCAAGTGCAACCTCATCGTGTTTCACGATCTCTTCGATACTCTTGAAAGCACCcgcgtcttcttccggtCGATTG
TCGCTCGAAACGTTGGTGCTCGAGCGCTATTGTTTAACTTTCCAGGCCAGGCTGGCACTGCTTACGCCGTGGATGACAACGctagtgaagaagacaaacT
CGTGCTGAACAACATGTGGCTAGCGCGTCGAGTGCACGAACTACTCAATTTCCTTCAGCACACAATGCAATTTGTGACCACTGGAGCCCCTTTCCACATT
ATCGGGTTTGGCAATGGGGCAAATGTAGCAACTTGCTACAGTGTGTTGTATGGCAAAAGTTACGACGGATATTTGCAATCCCTCGCGCTTTTCAATGGTT
TTGCGAGTGTGGATGCACAGCTCGCCGCAGTTCTTCATAGTGCCGTGAATGTATTCGCTTGTCTTCCAATGTCACGTCCAGATTTGCCAGTGTCGTTTTT
CAGCAAATTCCTGTTTTCCGAAGCGTATCTCCATAAAGTTGACATGAACTTGGCGCTCAGTATTTACACCGCGGTAACCAACGCCATTACACTTGACGGA
CGAATTCGCTTATGCCGTGGAGCGCTTCGCCACGTGGATCTAAGCTCTCAATTGGAGGATATTCAAGTGCCTCTTGTCCTCGTTCAGTCTGTGGAGAACA
CGCTCGTCGCCCCCACTAATGTCGATCCGTTCCTTCAAGGTCGAGCCAATATCCAGCACGTGTGGTCTCATCAGCAACCGCATACAAGTAGCCTGCGATC
CAAGACCCGCGTGCAGTTGAGGAAAGCGTTAGCAACACCCAAGAGCGCCTTTGTATCGTGGATCCGAGCCGGACATGAACTCCGTCAAGAAGCCAAAGGA
TACGTGActgaggtgctggagatgctcGTGAATTGTCAAATGGAGATGACAGAGAAGGAGCGGATAGCAGCGCAGGAACCAGACGAACAGCAAATGCTAA
CAGTGCAAGAAGTAGAGAAGCAGGTACCGATCGTGACAAAGGAGTCAGGGGCTGTAACCCAGCCTCTTCCACGTACAATTGATCCTCAAGAATCAACGTT
AGAGTCATCAGCTCTTTCAGTTCAGAAATCCAGCAAAACTCCTtacgaactgcagcttgagaagTCTGAACGTGCTTATCAGGAGGCGATACGGACTCAC
GAGACTCAAAAAGCGGACAGTGAAAAGAAAAAGTGGTTGCGCCAGCAAGAAAAGCAGGCTAAACAGACCTCGGATGCTGAAATCACCCCATTAACTCATC
CCGTTGCCCCCGCGAACATGTTGCTGCCTCCTACTATTCCTCCTGCAGTTCTGCCTCCGCAGCCAGTCTCAAGTTACAGCCACGAAGATGAAACACCGAG
GCAAATCGAGCCAAAAGAGCGTAATGGCGCTCGCACGGACGACATCGAAAGCGTCCGAGCTAAAATCCGTGCTGAAGAGGAGCGTATCGAGAaggaagcc
gaagagcagcgtcAAAAGCACCGCACAGCAACAGAAGCGCGTATGGCAGCTCTGCGAGAGGAACAagagcgaagacgtcgtgaGTGGGAGGAGGAAGATC
TCAAGCGCTTAGCCGATCTCGATGCTCAATTGCAAGCTCAGCAGGCCGAGAGGCTCGTTGCATCCCAACAGCGAAATCTCGAGCAGTTAACGAAGGACGA
GGCTGTACTCTCAAAGTCTGCGCCATTCATGACACTGGAACCGTCCGTAGAAACGCCCATTACCTCCATTCAGTCTCCGAAGGCGTTGTTGGCTCCGTCT
GCAGAGGAAACGCGGCAAAAGCTTCGAGAACAACCGGAACTTCCGAGTTTGTTTGACCAACTCGAGGCCGAAGAACAAGCTCGCAAACGACGAGAGCAGA
AACAACGAGCTCTTGGACCTGGTTTAGTGGCAAAGAGTCATCTGACCGGAGAGCAGTACGACGAGGTGCGTTCTTCCCTGCAGGAAAACTTCCGCGACGA
TACTCGAGCCAACGAGTCCAACATGAAGCGTGAGTTGAGGCGAAGACGTGACGCCCAAGCCACTCGAGTGCAGAAGTATCTTCGTCGCTTTCTGGCCGTG
CGTCGAGTAGATCGAATACGTCGTGAGATGCAACAGGAACGAGTCAAAAAGTTCGCTGGTGGGGAAATCGTGCGGGTAGTTCGAGGTCGATTAGGTCGTC
GACGATTTCGCCGAGTGtttgaggagaaggaagaggcaGCAAGACGCTTGCACGCTGCAATTCTCATCGAGACCGTCTTCCGAGGCTTTTATTGTCGGAT
AACGTACCGTGCAAAGCTGCGAGAAAGCAAAGCTCGTGTGCTGGAGCGGGTACTTCGTGGCCATCTTGGCCGCAATCGAGCTCGAAAACTGCGCAAGGAA
CAGGAACGGCGCCGCTTTCAAGATCGAAACGCAGCTAAACTGCAAGCAACATGGCGAATGTATGTCGCACGCGGTAAATTCCTTACTGCTCGGTTTTCGG
AGCTTGCAGCGCTTGAGATCCAGCGGATGTATCGAGGTCTCTTAGgccgtcgagaagctgcacgcaAGAAGCAGTGGCGTGACGCACCACCAGGAGCCGA
ACGCCTGGCACTTGGGCTCCAGTTGATCGAAGGCTCCAAGCAGGCGTTTGAACGACAGCAGAGCGAACTGGACGCACTGCATCgcgcgcaagaagctgct
gagcgaCAAGTGAGTGCCGTTCACACTGAACTACGTGAAGCTGAGAAAGAactcgaagtgctggagcggGAGCTACAAGAAATCGATCAGCTCGATGCCG
ACGTACGGGAATTAACCCACGAAGCCGAACGTCTGCATGCCGGTGGCGTTGAGGGTTTACTACGGAATCACCGGTCgtcgcttcaacatcaaagTCTCGG
CAACGGAATCCCTGACACCCCCTTCTCTCTGGACAATGAAGGCGCACCGTACGAATTAGGCGCCGAAAATGTATTCGAGTCGAAAGAAGCGATCAAGAAG
CGCCAAGCAGACGCGTATGCCGTCGAGATGGCGCTCAGTATCAAGCGCAGcgagcgcgagaagaagaagcgcgactTGGAAGCGGAGTTTGCGAGTGTGT
TCGCCGAGGTTCAGCGGAAACGAGAAGCGCTTGCAGAACTAGAAGAGCGGCTCGCAGATATGGAGCAGACTCGAATGCGAAAGGATCGCGAGTTTGCTCG
TCTGCAACGGCATCTGAtggagttgctggaagagcagaagctcgaACTCGAGAACTTGCGTGAAAAGGGCATCGAGCTCGAGACAGCTACAGCGACttca
gcggcagcagcggcagctaCTGCAGCTAAAGCACGTGAGCATGAGGCGAGATCACAGGCCATGTTCGAGTCCACCGAGGAGCTCATGAAGTTCCAGTTCA
TGTCCATGTCCTTATCGTACTTCAGCTCTCTGAACATGCTCAAGAACCTGCGCGATATCAACGCCGAcaccactgccgctgccatCACGACTACAGCGGA
GACGGCTGCtactgcagcggcagccGCGGCCGCCGCCAATATCACTCCTGTCACCGCAGCATTTGCCAAAACGAAAGATAGAGATGCCGTTAGCAATTTG
CTTTCAACGGTGAGCCAGCGCAAGCAACAGGAACtggcacagcagcaacgcgaagagcaggaggTTTTAGCCCCagggaagcagcagccaatgCCGGAAG
AATTGCGCGCGTGGACGGTGGACGACGTCGGTCGATGGCTTGACAGCTTGTCCTTGCCTCAATACAAGGCGGCGTTCCGTGAAGGTGCTGTCGATGGCGA
GTTCCTCATTGAGCTTCGTGCCGAGGACATGGCGGAAGTCTTGGGTGTATCGCACAAACTCCACGTGCGTAAACTGATGGTGGCTCGCAACAAGTTGCTG
CCATTGACAGCGGCGGAGCGAGCGCAATTAGATGCTGTTAACCATGAGGCTAATGCTGCACGAGCGCGCGGACAGGAACCGGCCGGTGAAGAGATGTCGT
TGGAAGTGGACACCGTGTTCTCGCAGGCGCGCAATGGCCGGATGAAGCGGCTGGTTGAGAGTCTGGATGCTGGATTCCCTAtcgacagcgaggacgacaA
GGGCAacacgctgttgctgctcgcCTGCCAGAACGTGAACCAGAAAAtggtggagctcctggtcaCGCGTCGAGCCAACATCAACCACCGCAATGCGCAG
GGCAACACACCATTGCACTTCGCCATGGCCTACGACGGTGAAGGAGTCCTGGGCGAATATCTGATCGCTCACGGGGCTGACGACACCATCGAAAACAACA
GCGGTCTGACGGCCTACGACGGGCTCACGGCCGAGTAAAATACGTTGTAGAGTAAAGCAACAAGTTGGTTGAGATATTCGCTCCAGTTCGCATCGTTCGC
GTACGCTGAACACTATATTTTTGCGCTGATGTAGAGTAGACTTCCTCACATCGATTAGATAATACATACGCACAGCACTCGCCTGATCGATCGCGGCATA
CTCGCTTGGTATCATACCATGATGGCAATTCCAGGCTCAGATTCGCAAACGCTGACGAAGTCCTTGTTTCTTGGATGTTGTATTTTCGTAATCTTAGGCG
TCCACCCGAGCCTCAGTAACACCACGTGCCTGCGACGCCATCATGCGGTTCACAGCGTTCACGTAGGCAGTAGCCGAAGCGACCAGGATATCCGTGTTAG
CACCGTGTCCAACGAACTGGCGGTCACGAGTGACACCCGTCTGGGCGTTcacgtgcttctcgtcctcagtcttctcctcctcctccttgtctTCCTGCAC
CCGCACAGTCACTTCACCCAGAGCGTACGTGCCATCCGTCACACTCTCAACAGAGAAGTCGTTCAGCTTGATGCTCTCCTGGCCCGTAGCGCGCTTGATG
GCCACATAAATGGCATCAATCGGACCAGTGCCCATAGCAGCCTCGCTCACCTCCTGGCCGTCCTTGTGTGCAAGCGTGACCGTGGCCGTCGGCTTCACCA
GGTTACCAGCGGTGACATGCACAgactgcagcgtccagaagACTTCAGGCTTGAACAGTTCGTCCGAAACAATCGCCTCCATGTCAGCGTCTGTgaccgt
cttcttctcgtcagccagcactttgaacttctccacgtaGTAGTCGAGCTCCTCCGGTGTGAGGCTGGTGTAGCctagctgctgcagacgcttgcTGTAA
GCGTGACGGCCAGAGTGCTTGCCGAGCACCATCTTGTTTTCGCTCAGACCCACAGACTCCGGTAGCATAATCTCATAAGTAGCCTGGTGCTTCAGCACAC
CATCCTGGTGGATTCCAGACTCGTGAGCGAAAGCGTTCGAGCCCACAATAGCCTTGTTGGGCTGGATCGACATACCAGTGTAGTGGCTGACCATACGGCT
GCAACGGGTGATCTGCGTCGAGTCCACGTCCGTGTAGACGGGGAAGTGCTGCGGGCGAGTCTTCAGAGccatcaccagctcctcgagGGCAGTGTTACCG
GCACGCTCGCCGATACCGTTGATCGTGACCTCCACCTGACGGGCGCCGCCCTGCACAGCGGACAGAGTGTTGGCGGTAGCAAGACCCAGGTCATTGTGGC
agtgcgtggagaagatAGCCTTGTCGCTTCCCTCTGTGTTGTCAATCAGGTAGCGGAACAGCGATCCGTACTCTCCAGGAACCGTGTATCCAACCGTGTC
GGGGATGTTAAGCGTCGTGGCGCCGGCCTTAATGACTTCAGCGAGCACTTCACACAGGAAGTCAGGGTCACTGCGCCCAGCGTCCTCGGTAGAGAACTCC
ACGTCCGATGTGAGGCTCTTGGCGAACTTGACAGCGTCCACAGCGCGACGGATGCACTCGTCGCGCGAAATCTTCAGTTTGTACTTGAGGTGGATGTCGG
ACGTGGCCAGGAACGTGTGGATACGGTGGCTAGGCGCGTGCTTGACAGCGTCGTagcagcgctggatgtccttctccatggcGCGTGCGAGACCGCAAAC
AGTCATGGGCTTGCCCGTGGCGCGATTCGCGGTGAGCGGGCCgatctccttggcgatgGCAGACACAGCGTCGAAGTCACCGGGGGACGAGATGGGGAAG
CCCGCCTCGCACACGTCCACGCCCAGCGCACTCAGGCTGCGCGCAatgtccagcttctccttgaagtTGAGCGTGGCGCCAGGCGACTGCTCGCCGTCGC
GCAGGGTCGTGTCGAAGATCACGAGACGCTCTTTGTCAGCCTCGGTCGCGGCTGCGTTCGAGAAGGCGCGGCGCGCGTTGGCTCTGGCCACGGAGGCCGA
GCGCTTGGCGATCGTCTGCATCATGTTGCTACTATGAACTGGAGCTATGGAAATCAGGAGTGCAGGTCACTAGGGCTGTGTGCGCCTCGGGTCGAAATGC
GGAATGAGCGGAGTCGGAGCCACGTCGGCTGGTTGAAGGCCGCGGCCGTTTGAGCAAACGTGCGTACTTGGCCGGTGCATCTTGTCCGTGCCTTGTgtgc
accaccagcatcagtATCTTGCACTGGACCAATGGGATTTTTGTGTTTGGAATTTTGACCAATGGTATGTAAATAAACGAAGCAGGCCATGAAAAAAATC
TCCTGgcggagaaggtgctcaaAAAGTGACAGGCATGGTTTGTCCGGTGCCACACCATCGCTTCACCACAAGAATGGGATCGATCGTTGTCGTGGAAGTG
TACAGCAGGGTCCGTAAACGTTATAAAGCGGCTTCAGCGTTGATGGCGAGGACAAGCTTAAACAAAGGTCCACTGGCAAGTTCAACATGAAGGGAACGTT
CCTGAGTGTAGCTCAACATGGCGGTTGGTGGCAACAAGTTGATGCAGACCCCGCCACCATGAGATTTTCCTTGTCTGGATTGCCGCGAACTCGTGGACAG
CTACCAACTGATGTTTTCCTCGCCTTGACACTGTCAAATTGACTGGCCGTCAATGCTGACAGCTTAAAAATGGCTGCATCAATCCGAATGATTAGAGTTG
CTGGAGTTGCAGGCAATGCTCTGAGCACTGCTCGCCTGAATTTACAAAGTTGGCTGACGCCAATCCCGACAAATTATCCCTTGCCACGAGCGTCGCCCTT
TTCTTTGAGGTTTCATCAGATGATTGCCTTCAACCTGGCCTTGAAGGCAATCGCTTCGGCCGAAGGAGCAATGTTCGCACTTTTACGAGTGAAGCGGgca
tgcacatgtactgtgGTTCTATCGTGTTGACATGCGATCAAGGTCTCCGTTACCTAAAATTGTACCAGCGTCATGGTACATAAGATGAAGCACGATTGGC
TGATTTCCTCGAAAACCGTTACGCCAAACGGTTACGCCGCGCGGTGCGCCATTCTGCGCTAAGAGCACAATCGGTAGAAGACAGCACGCAGAGCCCCACT
TCCGCGAGCATGGCATCCCGGCCGCTCCCCCCTGGTCGTCTTGGCAGCGACACTCTCTCCCCTGTCCGGCCTAATGTGGCGCTGCGTTGGGCCAGAAATG
TCGCGACAGCACCCCCTGCTCCTAAGGATGCGCTCTCCCCGGTAAAGCGATGGCCGCCAGTAAAAGCTCAGGCCCCGCTTCAAGCTCCAGGGGTCGTGTC
AGTAACATCGAAGGCGGTGCCCCAGCCTGCGGTCAAAGAAAACAGCTCAGTATCTGCCTTCCAGTCGGCGCGCGCTGTGTttgaggccaagaagactTCT
GCTGTATCGCCCCCACAACCTCCCCCTATCCGTCACCGTTTTGCATTCCCCAGTGAGAAGCAGCACTCTACAACATCCGATTTATCGGCCTCATCGTGCA
GTACATTGGACTCCGAGAGCGATCGAAAGCTGGAAGAAAGTATCGCAGTAAACTATGAACCAGAGCCCTCGTCTCCAGTTCGCGTTGTGGTGAAAAAGAT
GGAAGTGGAATTAGCCGGAGCTACTCCTTCCGAGCGAATTATAAGCACGGCGTCGCCTTTCCGAGTTAATTCCGTTGTACCCCCACCGTGTAAAGTGGCT
CAAGCACCTCCTCCATGCGAAAATGCAACGATCTCGTCTCCACTCCAGCAAATAGCTAATGGCGCGTCCGATCACAGTGAGATCGATCCatttcgccttc
ttcttcccatCGAATCTGTCCCGAGGCTTCCCGACGAGATTATCCGCGTTTACGACAGGACTGCAAttgagatggagaagaacatcaagaaggtggtgcg
tAAGCTGCTCAAGAAAGACAAGGTGCGATTGGAGGAATTCAAGGTGAACTCACGACTATTTGGGACCGATTTCATGGACCCAAGTGCTTACTTGGATACG
CTTATCAAGGACTTCGGGTCTATTCGTGCTTTGCAACTGGTACCTTGCTTGCTTAGCATCCAGCCGAACTTGCTAAAAAGCAAAGATCTACTCCTCACAG
CCAAAAACTATTTGCTACGAAACCAAGATGAGATGAAACGTGAACTCCAGAGATTACAGCTATTGAGCTCGAAAAAGATCGCCACCGTTAATGCAAATCC
TGATAACGAGGTGATACCCGCAACTGTTGCAGCCTGCGATGGGACCTCGACTGAAGTATCTTCCGtcgctaccggtagtacaAAAACGACTCTCCTGGCA
AACGACGTGGCTTACCCGACAAGTGGCCATGCTGTCAGTGATCCTGTTCATCTTGACACTGCCTTCCCCAaaactgcttctccagttATTCAACCTCCCG
CTCTTACGGTTGTACCAGCATTGATGACTGAATTTGTCCAACAAAAAGTCAATGGCTCTACAGAAGTGATGGCAAAAACCAAGACGGTAGAACCGATGCC
TGAATCTCAAGTGACGACACACGGCGAAGCCCCGCCACCGTTCTTAAACATTGCTGTTAACACTTCCAGTAGAACTCCAACAACGGCCCCAATCGTGCGA
AAAAATGCTGCTACCACAGTTGCGGCGAGATCCGCTGAATCGGAAATCCCCATCAAAACCGAAGAGGGTTGTAAAGCTGGAAACCTATTCGGGGAGAAGA
TACAAAAGTCACAGCAGGCTGAAATATCTGCTGCATCGATCTCTCCGGTCTCCTCGGtgcacagcttcgacgaagcagaaagcTTGTTCGGAGAGCGTTT
GTCCCCGTCATCACGCACCAGCACTACCCGTCGAAAGTCTGTGACGTGGGGAGATACCCAAACAATGGAGATCCCTGACAACGCTTCCGTGATCAAGACA
GTAAAAAAGCCTGCACCGCTTCTTTTTGGTCTCGCAACCGCAGCCGCCTTTgagtcggacgaggacgagtcAGACTTTAGCGATTGATATATCTTTGAAG
ATTCGTGAATTGGAATCCTGTGTTTCAGAGATAAAATGTAAACTGCAGTTGTATG