Description :
From Genome Similarity Track
Location :
Scaffold_138:1842- 10009
Transcript NameFunction/comments
Physo_143390reverse transcriptase
Physo_143391hypothetical protein

Sequence
8167 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTCGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTTTGTGGTCTCATCGAGTGAGCCAAGATGGATCGGACGGAGTTTCCTCATCTGAGCGACTCGCAGTACGAGTCCGTTCGGAAGATGGCAGGCA
TCTTTGGGGCAGATGCCCTGCGTAGCTTAGCAGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATTAACGCGTTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAA
AACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTG
GTCGCGCTAAGAGTTGGACGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCC
GGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCC
TCTTTGGTGGGGAACCCCCTGCCTGAGCACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAG
CAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTC
TGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGTCATGGCCGAGCAGAGCGACATTCGCTGCTACGGC
TGTGGCAAGCTTGGGCACATGAAACGTGCCTGTCCCGCGGGAGGACTGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCT
GGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGT
GGCGCACGCCATGGGGACGTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGTACGCGAGTGTACCGGGAT
ACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGTGACAAGTACGCCGATGCGCT
ACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAG
GACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGATATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACT
GGCGCGGCAAGGACATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGTGAGGG
CCGCCAGGGCGCAGCAGCGTCTAATGAGTTCTTGGGGCCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGAC
AGCACCTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTA
ACCAAGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATATTTCCACAGGAGGTCACTCAGAC
CATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACTCGGCGAGGTGGGTAACATAGTCCCACCCAGCAAGGCGGGTAAC
CAAGTTCCGCTCAAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGGCG
GCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCT
CCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGT
TGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGC
CGAGTTGAACTCGTCCTCGGTCATGGACCAGGAAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGG
GACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAAGATCCACCGCCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATC
TCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGG
CATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGAAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAAC
AGCGCGACAGTGCCTGCGCAGACACCGATTCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGAGGACG
GATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCT
TTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGC
CGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACA
AGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTG
GCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTG
TCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCACCATCAAGATGCTTTTAACGGCATCAAAGCGAACTTACAGCGCGCGCCAGTCCTGG
CATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACG
GGTCATCTCGTTCCAGTCCAGGCAGCACAAGGCAGCCGAGCGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTC
CGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCGTCTCTCACAGCGGATGGCGC
GTTGGCAGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGA
GCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGAGCTCTTGTGCGGTTCTTGGCC
GCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGC
CCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGTGCACGACGCTCCATCCAGTGGCCATCTCGGCCG
TGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTG
AAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGGCTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTTCCGGCCG
ATGACGGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTTGTGACACCGTCACTGGCGACGAGGTCGC
TCGCCTGTTCATGGACTGTGTCTTCCGACAGCACGGTCTGACCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTG
TTTCGCCTTCCCGGCACACGGCTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAGGACACGCTCC
GCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCC
CTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTT
TTCTCCCAAGTCTCGGACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATACTCAGCAGGGTGCGAGACACCA
TGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAG
AAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCAGCATGGCGCGGCGTAC
ACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAG
CGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCG
TACATCGGATCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTCCGGATACGGCGCGTGGCCATGAA
GCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATA
GAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGG
ACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGC
CATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCATGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGC
GCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCTCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATG
GGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCAC
GAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGGGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTC
CAGGATTGCGGTCAGAGTGCGATCCTCAAGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGCGGTCTTCCACCTCG
TTCCAGGTCATGTTCTCATTCGTCTTGACCCAGTGGTAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCT
TCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACC
CCTCGAGGTGTACCCACCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGG
TACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCT
CGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACCCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGA
CCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGTCAGCGTCAGA
TGCTTGGGTGGCGACACCGCCTTGGGCTCAGAGCCCGTGTCGCTCGACGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGAGACT
GCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGTCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTC
CGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGTAGTACTGGACCATCGTGCAGTCAACGACGGCGGCT
TCCCAGTCACGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCT
CCGGCGTGCTGCTGCGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGG
CCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGA
TGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTA
ACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACTCTGTCACTATTCCGGGATGGCTACAT
CGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCTAACAGACACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAA
ATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGG
AGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACAGCGCAAGAACAAGCC