Description :
From Genome Similarity Track
Location :
Scaffold_39:18417- 21032
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_39-snap-gene-0.27Phospholipid-transporting ATPase

Sequence
2615 bases(100 bases per row)
AGTTTTATCCCCAAGACATTGTTCGAGTTTTTtCGTGTGATCGCCAACTGCTACTTCCTTGTGATCTCAATTCTACAAGTCGCGACACCGTGGTCTCCAA
CGAACCAATACACAACAGCTGGTCCTCTCGTTATTGTGCTACtCGTCTCAATGACCAAGCAGGGGATCGAAGATAAGAAGCGCCATGACGCTGATGATAT
CCAAAACTCACGGAAATGTCGCGTGCTTGGTCGCCACGGCGAGACAATTGTCAGGCAATGGCAAGAACTGCAAGTTGGcGACGTACTGTGTCTTAGTGAT
CGGGAGGAGTCGCCTGCAGACATCTTCATCCTCTCCACGTCTGAAGAAGAAGGGCGGTGCTTCGTAGAGACCTGTAACCTCGACGGAGAGACAAATCTCA
AGCGCCGATCTGCCATTGAGCAAGTTGCTAAACATATTGGATACCGCAAACTCAACGATCTCGCTCTACCCGAAGAAGCACACGCGAAGAATATGATGAA
ATTCCGAGCCGTTATGGAGTATGAGCAGCCGAACAATCGCCTTTACAACTTCACAGGTCGGATTGAATTTGGCGAGCCAAAGGAGTCCGTTCCCATTGGC
CCCTCCAATATCATTCTGCGTGGGTGCAGCATTCGAGGCTGCTCGTACATCTATGGCCTCGTGATTTTTACTGGTGCCGAAACCAAGCTGATGCAAAATG
CACGAGCGACACCATCCAAGCAAAGCAGTGTGTATCGTATGGTCAACCGATGCATCTTACTGGTCTTCCTTACTCAGGCAGTGCTGTGTATCATCAGCAC
GATCTGCAACGCCGTTTGGACGGACCGGTACCAGGCGAAGCTGTGGTACTTTGGCTCTGCCATGGTCAAGCCGTCACAGCTCTCACAAGTGGTCAGCTTC
TTCACGTTTCTTATTCTGTACAATAATCTCGTACCGATCTCATTGTATGTGTCGCTTGATATGGTCAAAGTCATCCAGGCCAAGTACATTGCTATGGACA
ACTGTATGTGCTACGAAGGCAAGTATGCGATCGCACGCACGTCAGACCTGAATGAAGAACTCGGTCAGGTTGAGTACATTTTCAGTGACAAGACGGGTAC
ACTCACGCGCAACATCATGGAGTTTCGGAAATGCTTTGTCGAAGGTGTGTCATACGGCTTCGGTACGACAGAGATAGGGCGCGCAGTCGCTGAGATGCAG
AAACGCACAGCCAGCAAAACGAAaGTAAACGATACAGCCGTCCCAGAGGATTACGAGGGTGTTCATGATCCTCGAGACGCACAGGTCGAGTTTGACCCAC
TCATCCACTTCGACGACCCGAGATTGATTGAGGCTCTTGACCGAAACTCGGCAGCTGCCGCAGGCATTGACAAGTTTCTTACCGTGTTATCAGTGTGTCA
CACTGTGATTCCAGAGATCAATAAGAAGGACGGCAAAGTAGAATACCGGGCGTCATCCCCCGATGAAGAAGCACTTGTGAAGGCTGCAAAATGTCTAGGT
TACAACTTTACGTCGCCGGCTCCGATGGTAGAAATCCGTGTGACGCGCAAGAGCGGTGCGTCGACGGTTCGGAAATACACTGTACTAAACGTCAACGAGT
TCAACAGCACGCGCAAACGCATGTCATTGGTCGTGCGAACTGAAGACCATCGGTATATCTtGTACTGCAAAGGTGCCGATAATGTCATCATGCCACGAAG
TCGGGAGAACAAACACACCGAAAAGCTAAACGAAGAACTCAAACGGTTTGCGAGCGAAGGTCTGCGAACGCTCGTGCTCTCGCGGAAAGAGCTGAGCGAC
AACGAGTATCATGCATGGGACGCGAAATACCAAGCTGCTGTGACCTCACTCAGCAACAGAGAGCAACTTCTGGCAGATGTCGCGGAAGAGCTTGAGCAAG
ATATGGAGATTGTTGGTGCAACTGCAATCGAGGACAAGCTGCAAGAAGGTGTCCCGAGCGCAATCTTCAACCTAGCTCAAGCGGGCATAAAGaTAtGGAT
GCTCACAGGAGACAAGGAGGAAACTGCGATCAATATCGGCCACGCATGTCGTCTGATTAACGAAAGCATGCGGCTCTTGATCATCAATCAaGAAAaTGTC
AATCTGCTGATTGATCAAGTTGACGAGCTGTTtAGAAGCGAAGACGTGCAGTCCCATCTGAAAAGCAAACGTGTCTCAAGTCACCTCGCCAtCGTTTGCG
ATGGCAAATCGCTTGTTCACGTCTTCCcACCGAAGAACGCAACGATCAACCCAGAAAAGgAGgCAACGGCACGCGAATtGGCTCGAAAGATTCTtGAGAT
GTCAAGTGTGTGCCAAGCGTTGATTGCTTGTCGAGTTTCACCTGCCCAGAAAGCTGATATCGTCAATCTTGTGAGGTACCAATCGCCACATAAAGTCGTC
ACGCTCGCTATTGGTGACGGTGCAAACGATGTCAACATGATTCAATCAGCGCATGTTGGGGTAGGAGTGTCGGGCCAAGAAGGTGTACaGGCAGTAAATG
CAAGCGACTATGCGATTGCCCAATTCCGATACCTGGAGAGATTACTTCTCGTGCATGGTCGTTtCAaCTATCGCCGCGTCTCGAAGGTGATCTTGTATTC
GTTCtACAAGAACGT