Description :
From Genome Similarity Track
Location :
Scaffold_96:184166- 186608
Transcript NameFunction/comments
g7517.t1hypothetical protein

Sequence
2442 bases(100 bases per row)
GTTGTCCACAATGACTAGTCTTCAGCTGTGGAACCAGTGACCACCTCCGGCTCGGACACAGGACGCAGATCAATCGCCAGACAGAGTCGACAGCGTACCT
CCAGAAAGAAGCTCAGATCAGTCGTAGAATGTGGCACAAGATGCCAAGAATGACTTTAGCGGGATTTGCAAAAATATGGCGTCTACAATGCCAAAACCAC
AAAAATAGCTACAGCATGTTCATGTTATTGCAAATATCATACAGTGTTAAAGTAACACTAAAAAAAAACTTATCCCAAATAACGTTATTTCCCGTGTTAG
AGAGATAACGGTAACGTCGCCACCTCTACAATTGAATTGTGCAAGAACTTGGGTCTGATGGACAGACGTGGTGAATATATCGTAGGTAGGCGCACGAGCG
CAGAGCAGAGGGCCCGCTGCATCCGCCAGAAATGTTCGGGAACGTGGAAATCCATACAGTATGATGATAAAATGGGAAGAGAAAATTCATGGCTGAAGAC
AATAGCATACTTCGAAGACCCTCGTCTTGCGCAGTTGGCTTAACAAAGCGATTTCAGAGGTATATGAATTATAAAATAATAGTTTGATAGCATTTCCCTT
GCATTTCCTACCGGATATACCAGGGTATTTTAACATTGAGGTGCCCATAATGAGGAGTAGCACTGTAGCTGCGATTTGTTGACGAACTGATGCTGATCGT
GAATGATCGTATGCATGATGTGCGATGCGATTTGAGCTTTGCTCTCAACAGTTGTTGCATGTGGTGACTTGAGATTTAAAAATTGATTCTTCGATAGTGC
TCTGACTTTTAAACGGAAAAACGTTTTCAGACAGAGGATAATCACAACAATTTGATCAAAGCTACTTGACCATCAGCTGCTTGTACCAGTACGCTCCAAC
TCTTCCGCCGAAGCCTTTTGAACATGAACATTTCGTGCTGTCTACTAGTAACATGTGTTGATGAACGATCCAGCCCGAATTCCGCGCTTCAAATCTATTG
CTGATTAATTACGCGACAAGTTCCTTCAATCGATGATTCATACGATGCTCGTCGCTCATCGTTACTCAACGGGCATTTCTCATAATCACTCATCGTAACT
CAATGGGCATTGCCCGTAATGGTACCATGTGCGCTGCTGTGAAAAGTTGGTGACGACGATCCCATTCCACAATTTCCCCGCCAGACCACAACTCCCACTG
CCTGGCACCCTCGTCATCTCCACACTTTCAAGAATCAACAACAAGCATGCGCTTCACATACATTTTCGCGGTGATTATTGCGGCCACTCTCCACGCCAGC
GGCAACGCGCTCTCCACAGCCAAGGAGTCTAACCACGCTGCCATCTCACACGTGGCGTCCGCGGATGTCCAAGCGAACCACGGTCGACTCCTCCGTCGAG
TTGAGAAGGACGGCGTCAAAGAGCTCGAAAACGAAATTGAAGAAGAAGAAAGGACCTTGAAGAACTTTGGGGCGTCCCTGAAGAGGTTCGCGGCAAAGCA
CACACCCTTCACAAAATCCTGGAAAGAGGCTAGAAAAGTCAGGAAAATTGCGGAGGCGGATGCCCGCGCGAGGAACAACTACAAGAATTTTATAGCTTCG
GGGGGGAAACCCGAGGATCTGCTCCATCTATAGATACCACCCGCCCGCTGACCGACAGGATGTGTGGACCGGAGGCTTCTTATCCAATACTGCATACCAG
TACAGCCTCACGCTAATGCATTCACCCTTTTTCAACTTTGATCTGTGCTATATGCCTATTTTGACAACTCTGTGATAAATTGCAACGGCTGTATACAAGC
TACATGTACTTCATCGCCCGATGCTTGGTTTGATGCGACGGCGTCGGTGATTTTACCACGAGCACCATGTGCGAATGTCCCTGGCTGGCAATTATTGTGC
GCACGATGATTCAAGCGATATACCGATCGGAGACTTTCTTGTCTCGACGAACTGGGGCCATTCCAGCTGTGGCTTCACGATTGGGATTGCCCAGTAAAGG
GTGAGAATGGGGCTGAGCCGTGGCGGTGGTGCAGCGTGTTTCCGGGTAGGCCCTCATGCATCTTTGTTTGGTTTGCATCCACTGCTTCAGTGACAACACA
ATTCAACTGATTCGTTCTACGAGGCCTATTTTTTCAGAGCAAACGAGAAAACTGAGGTTAGTATGGTAGCGCTTGTTGCAGGTGCGATTGTGGTTGCTAG
CCGTCAGAACGAGTTTGGTGGCGTGCCGCTCGCAACCTTTTTGTCGGCCTTACTATATGAGCTGGGAATTACGAAGTGGCGGCATACGCTGATCAAATTC
CCCAAGAGCATGCAGAAGCTTGTCACTTCCCTTGTGGTGTCATTTCTAGTGCCGCTCACCGTAGACTGGCCGGATTTTCTTGTCGCAACCACACTGAAGT
TGGGGACTCGTGTGCGGATGGGTGCCATCTTCGCCCTCTGCA