Description :
From Genome Similarity Track
Location :
Scaffold_1198:1841- 6822
Transcript NameFunction/comments
g16805.t1hypothetical protein

Sequence
4981 bases(100 bases per row)
GCAGGTTGCCCTGGATCAGCTTGATCGTCCCACCGTCCCCCGTGCTATCTGGATCCCTGGATATTGCGCTCGTTCTCGTAGGGCGGCCGCGGACGTTCGC
CCGTGGTCGGCGAGCACTTTGAGCCGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGCCTAAAAACTGGCTTTTTCCGC
CGCAGAGTCGATCGCCTCGTCACGGTGCTTGGTCACCCGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAA
CGTCTTGGTGACACCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGG
GAGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACACATATCTGGCACGTCTTTGGGAAGATCGCAAGCATAGACGATCACGTTTCG
GTGCCGTCTGGAAACGCTTCCTCAAGTTGATTTTGCAAGGGATGATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTCTTTCTGCATTATCCC
CGGGCGCACGAACAACGAGTTTGGTACCCTGGGCTTGGTAGCAGCTCTCCGCCGTCCAACCTGGTGGACGCCCTACGTGCCGTCGATCTGGTTGACCCGT
GGCGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGAGCTCCTAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAAGTGGT
TAGTGGATCGTATATCTTCTCAATATGATCCCCACGGCTTCTCCCTTCGTTGTTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCACTCTGATCGA
GAACAGTCGTCCTCGATCTACACAACAATATCACATAAAACCCTTCCTTCTCGATGTGCGGCCTCCCCGCACATCTTTCTTCACATCTTCCGCCCGCAAC
AGCCAACCTGCTACGAGCCCTCCTCCTCCGCCTCATGCGACTGCATGACTCTAAATCGGTTGCGGTTAGTTACCTCACGTTCATACTCAAGCAATAATGC
TCCGCAGTTGAGGTCGGCCTCGTCGACCCATGATGGATCTTCGTAGCCCTTCCAGTACACTTGGAACTCTCGATGAACTCGCCCATAGCGCGTACGCCGC
CCTTATCGCACATCCACAATCCTGTCAACCTCGTATTCGTCTTCGCCAAGGCTGCGTTCCCAACTATCTTCTGGCAGGATTGCTTCGTCAAAATCGAGAC
GATCGCCTTCAACCACGGTAAGCGCCAACGTAGGGCGATCGGGAAAACTTCGCACCAGCTTGAGCTTAGACACGTGGACGATCGGAAATAAGCGGTACTC
CGTGCCGGCAGTCTCCAGTCTCGCTGCGTGATTACCTACCATCTCGACTACCCGGAACAGGCCGTGCCACATATGCGCCAGTTTTCTCGCGTAGCCTTCC
TTCACCCGGTCCAGATACAGCCAGACTTGTGCACCAGCCTCAATCTCCTGGGATCGGACGTTCTGGTTGTGTTCGTCGTCTCGCGACTGGATCGCTTCCC
GGAGCCGCTCATTTACCTGCTCCGTTGCGCGTCGATATTGACTTTGCATGTGGAATCGCCATCGTTTTGGCTCGCGATCACGTCGGCGCGTGCTCCCGAC
GGGTAGCGCCGCCTCCAACGTGGATCGTGGGTCCCATCCGTGGATCAGATAGAACGGTGTGTCTCCACGCACACGATCGTGGGCCGTGTTGATTGCGAAT
GTGAGGCGTTCTGCGTACTCGTCCCAGTCCTGTTGGTTAACATCTGCGACGTACATCTTCAACGCTCGAGTCAACATCTGCACCATACGCTCGGCTGTTC
CGTTTGCTTGGGGTCGGTACGCCATCGTGGCTCTCTGTTTTTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGATACGAACCCAGGTTCCCTGTC
ATGCCGGATAGCCTCACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTCGCTTTAGCGATC
ACATAACCCGAGAACAGGTCTACCCAGATCAACAGCTCCGTATTGCCTTTGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACG
GGTACGTCGCTTGCACGTTCCCAGGGGATTCTCCTCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACACT
TCGGTATAAGCCCCTCCAGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATCCCTTGATGTCCCCCTTCCAGACTTGCGTGGTTATGATGTGGG
AAATCTTGTTGCAGGGTCTCAGGCACCACCAGCTTCGCGATCTCGTCTCGGCCCTCTTCCTGCCGCATGGCTGACGGGCAATAGAACAGCAGATCGTTTT
CGTCCAACTCGTAATCGTTCGCGACCTTGGCGCACGATTTAGCTTCAGCCGCGGTGAGAGCCTCGACGTTCCCTTTCAGGTATGCTTTCAGATCGATGAT
CCACTTCTCTTCATTCTGCGCTTGGATGATTCGTTCACCGCGCATGCGCTGTACAATCGTTTCCTGCAGGACTTCAGGAGTCAGTCGTCTGCGTCGCGTC
GATCTGGTCACAGCAGACACACGGACGACGGCATCGTCGTCCCTCATCTTGAGGAGCTCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCTTCGT
CTGAGGTGACTACGATCCCTTCGCCCCGTTGGAGAGCTTCACTGGCTAACTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGCTT
TGGCCACGACCTGAGCCGATCCATCGCTTTCTCGCGCAACAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATAACTAAATTG
GAGTCGCCGCAGATCACAATCCGCCCCCTGTCCATCGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTATTCAGCCTCGTTCACCGTCAGATCGG
GCATATACTCCGACGCGGCGGTGGAGATCGTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACGCGTGCCGATCCATC
GAAGCTCGCGACCAACAAAGTTTCGTCCGCTCCGATTGTAGGGGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCGATCGCGATCAACGCC
TCGTCTACTTCCGCTCGAGGTGTGATGCTTGCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCATTCTGATA
GCAAGGCTGCCCAGTTGCCAAGTCTCCCTTGGAGACCGGCCGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCTCGTCGT
CAACAGGGTGTAGATCACGTCCAGCATCCGCAAGGGTGCCAAGACTTCTTTGTCGACGTTCCCATAGTTGGTCTCGTTGGATTTTCGAGTACGACTGGTG
AAGGTTACTGGCCAATACACACCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCGTAGACCACGATTACCGGGGTGCGATCTGGAT
CGAAATGTTTCAATACCGGAGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATCTTCGCTCGGGCCCAGCGGTCAGCATCTTCTGCTCGCGTGAC
AACGCCCCCAGCTACTTGTTCGCTGGGGATGGACCTGTCCTGTCGGGCAATCTCGTGGAAGTCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACC
GCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAA
GGTCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCCCAGAAACTCTTGACCACGCTGATGGACAA
ATTCCATCGCTCGCAAGCGTCGAGCAATGCCTCTACCTTCTCACACAGCATGTCCCAAGTGATTGCAGTCACCAGAATATCATCGATGTACGATCGTCTT
CCCAACACTGACTGTCTCGGCTCTGGTTCCGGCTCGCCTGACTCGAACACGTCGATCGGCTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCAT
ACAGCGCGTTGTCAATCAATCGATGGTAGATCTGTGGCGCATTCTTCAACCCGAAAGGCATACGCGTCCACTCGAACAATCCGAATGGCGTGATAAAAGC
GGAGATCTTCCGTGCGCCCTCCGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTAAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGA
TCGCTAATCAGCGGCATGGGGTACATCATCAGTCTCGTCAAACTGTTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGA
TGATTACGATCGGAGAGGCCCACGGTGAAGTCGACGGCATGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCGCGGAATTGTGG
AGCGACCTTCCGGACGCGTTGTACAACAGGAGCCGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGGCCGGCGGTAGCGCGTTTCCTTTCCCG
ACCAGAAGATATTTCCGTCTCCAAATTATCTGTCGCAGCCGATCGATTTCTTCCGGGGTGTTCGACTCTGGATCGCCCATCTGGATATCTTCGATCGTAA
CCTCATCAGTGGCAGTCACTACTTCTGGTAGAATTGCCAACTGACGCTCCACATCTTCGGCGAAGAGATCGCCACCTTCGT