Description :
From Genome Similarity Track
Location :
Scaffold_385:1840- 4941
Sequence
3101 bases(100 bases per row)
TATTTTTCACCATCTTAGGTGTTGGGATTTGGTGGAGCTATCCATGTACATGATACATATATATACTACTTTCAATATCTTTGCCCTTCCCCTTATATAC
AAGTTGATTTGATTAGGGCTGAGGGAAATGGGTGCGCTGGAAACCCCTCGTATTGAAGGGGTTAAATACCTCATTGCATGCTCCACTCGGAGCAGTTTGA
ACTAGTGAGCTCGGCAGTGCAGGCTTTTCCTCACGATTTTGGGTTTGAAAACATTTGCGACCAAGGGTCTATAACTACATACGGAGAAAGATCACCAGTC
GGAATGATGGAGCTTCAGACGTTGATGACGGTTGTTTCGAGGCCGCCTTCGACCACAATTCATCGCCTAACGGGAGCAACCAACCATGCCAGCGCAGCGT
CCTGTAGACAGGAGTGCTAGGTTTGACATATCTTCGTTGTTGTCCCCCAGGACACCTGCTTCAATACAACCAGGTCATTTCGAGTCACCTACACGCGACA
ATTATCCGCGCCAAACAACTCATTATTCAACGGTAGATGGACGCCTGCCGCTTGCATCGCCTGCCTTAGGTATTCACGACTTGCTACGGTCGATAAGTTA
ACATCGACTGCTCTTTCGTCCTCATCAAGATTATTGTATTCATGTTTGTTACAATTTGGACCTCACACTTCCTAGGCTCGTGAGATATAGTTCTGACGAC
GATCGATCATGTCCGTTGGTGTTGCCAAACGGTATCATCAGCATTGAGCCACAAAGTCAGCGCTGATGTTTGCGATGGTGGTGTAAATGTGATGGATATT
GTTGCCCACTTTAACTATGCTAGCAATTGTCAACGCTTTTATAAGATGTTGGTGCACTTGTAGTTACAGTGCATTGTCTCGCTTTCCGCATGCTGAGAGC
GAGTCGATGCAGTTGTGCATGTGTGGCGTGGCGCACTGAGTTAGGCTCTCGTGGcaaccaacagcagcgtcgaaaaaaaaacagcGCTCACCGAAGGAAG
CTTGCTGAGTCTGGAGCAGAATGACCAAATGGTGAATGACGACAAGAGTAGATGAACCAGTCAAGAAGCAAGTGCACACGACAGATGCGATGAGTGAAGG
AATCCTCGCTtacttgctgctcgtggcctCATGAGTAAGAGCAGATGTGCGGAGCCGCATGAGGAAAGACTGCATACCGCCTAATAGTTTGCGTACCGTT
AGACCGCTCCCACACTAGACTTATCCGGCAGGCTTCCGTGGCGATCGAGACGGCTATCTGTGTCCCAAGCTTCCTATccacctggagctggaggaagtAC
TAGGCTGTAGAAGCCTGATTTTTGACGTCAAATGCCGAAACAGACCACCCGCGGTCATCGACGTGGTAACCACAGCCGtctcagcagcagtcgatTTTGT
TAATTCGTTATAGGAGCTCGCCCGCTCGATTCTCATAAGCTGCTCGTTGTCCGTCAACATTCCTTCTACGTCCGCTAAGTTCTATATTGCTCGTGACATT
TGTTAGAAGCAATACGGTGCTCGAACGCGTGCAAACGAATAATGGGCCGCCGCCTGTACCCATCGTCAACTCCAGTCGACGCGCATTGCGCACCGACAGG
TCTTGCAGCCCAGGCTGAGCGGTCGTTTTCTCCTCGTGCTTGCCTTCGTTGTTGTGTCGGATCTGTAGCTACTGCAGCTGGCACGACCGCTTTCTGATAA
AAGTCGATACATTGTGTTTCAGTTGACGATAAACGTCTCTCCTGATGTCTGTCTATCGTCTTCAATGCTTTCGTGTCCTGTTATTCTCTTTCACTGTAGA
AGTCGTTACAATATCTTTAAATCCGCTTCAGTTCACCCAATAAACATCGCAGTGTCAGGTGTGTATTGGTGCTTGGTACATATTTAGTCGACGGTCGATT
AAACCTACACTGAGAGCCCTAACCAGTTCAAACGTTAGCCGGTTCCGCTTTCGGGGAGTGTGCTCACCAATTCCTCTCATTACAGATTCATCAAAGAACG
CGTACAAGTCATGGGGAAGAAGCGAATTTATACGATGATCGAGAGAGTGAGAATCCTCAAGGAGTGGCAGAAAAATCTTCAATGGAAGCATtcgaaggcg
gcgatggGACTGGGCGTCAAAAAGGGGACACTACTTGGTAGGAGAAAACAACTCTCCGATGAAAAGCTTTCATATATCAAAGAACCAACATGTGTGGACG
GGAGATTTAGAAAGTCGAGTTCAGGGCCACCGAGAAAGGTTCAACCATACGAAGATCGCATGCTTCAATTCTACGAAACCTCTGGGTGGACGGTAACAAG
GCAACGCAGACTGAGATGCTATAGTACTGCAACCAAATGTGTGAGTTTGCGGCGCGGAACGACAATTCTAGTCGAGTTGGGTGTTGCGTTTCATGCGTCA
TTATTGGCCAATTGTTGTTCCGGagatcgccgtcgtcgcacctggagctgccaaggacggtggcgctgccgaACAGGCTAGCACAATGATAGATGTCGAC
TCCGACGTCGTTGGGTAACAAGTGGTAGACTCTGAACCCTCCGAGGCAAGCGTCATGGAGATAGATGACGTCGAGCATTCGGATGTCGCGCCCGAAGACC
TCAGTGCACCGTGCACGAGACCCCCTGAAACCAAATCACCACGACCGAGGACCctgacgaagcagcaggcgagcTCGGGTCCTCTGAGGACTATGAGTGC
CCCAGAGGATATTGAACATGAAGGCGCCTAGATAGAGGTCTCTCTATACGCATGCGGGTGGGGATCCCACAGCGCCGGGGTGAGGCAGCTACCTTCCATT
CGTGAGCGGGGAGACGGTCGTGATCCAGGCTGGTGTACAACCGGACTTCACCTTTTTAGTAGATTGGCTGTTCCAAAGGCCGATCTACAGCTCTTCCTCG
GTCCTTCGACAattccagctcttcaagtTCTAAAACAAATACAAAACAGGCGCGGAATGGTCATGGACGCCGATAATATTAAACGGATCCTTTCTAGCCC
GACAATAACCCGGTACCAGCGGCGCGTTACTGCCCTTCAAGCAAAGCAGGAACACCTGGGTGAAAAGGGCGTAGTTATTGAGGTAGAAGACATTGGCACT
A