Description :
From Genome Similarity Track
Location :
Scaffold_593:184- 5157
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_593-snap-gene-0.6Protein phosphatase 2C
Pytve_DAOMBR484fgenesh_masked-pve_contig_593-abinit-gene-0.243'5'-cyclic nucleotide phosphodiesterase

Sequence
4973 bases(100 bases per row)
AAGCGAGCTTCCCGACGATCACCATGCGGCTTCCCTCTGCGCGGACCATGTCGCGCCTGCTGGCCACGAAGCCCTTCAAGGTGCGCGTCTACTACCGTGT
CCTCGTGCTAGCCATGCGCAGAGCCCTCTCTTCCTCTGTGGATCGCGCCAAGCTGACGTTCATCTGCTGCCAACTTAGCCGACTGGATCGTCGCTGCGAC
ATGCACTGCTGATCAGCGGCATCGGCCTCTCGGTGCTGGCGCTGGCGCAAGCTGAGCTCTCGGAGTCGGGCGGGACCTGCTCGATCGGTGACGCGCAGTG
CGACGCCCGATACGTGCCGCCCGAGGCGGATATCCGCGCGTTCTCGGTGCCGCTGGACGGAGAACTGTTCCTTCCTGTCGCCAACTCGCGCGCCTCGCGC
GTCAGCTGCGCCACGTACAAGGCCAACTTCCCGATCGAGGTGCGCTGATGTGGATACGCACCGGGAGTTTCGGTTGGGAGACTCATGGCCTTGATGGTGT
GACTGCAGGACAAGTTCAGCATTCAGACATTGGACAACGGAGACGTGTTCGCGGCTGTTCTCGACGGCCATGGTACGCTCCTCTAGAGCTGATGTTGCAC
TGCGTGAGTGCTGACTGTATTGGTGTTGTAGGCGGGTGGCAGGTGTCCGAGTATGCGCGCAAGTCGCTGATCGGCAATGTCCAGAAGGAGCTCGCTTCTC
TGCGCAAGGGAGACAAGGACAACGAGTCCGAGTCGCGCAAGCCGCTGTCGGACACGAAGATCGCAGGCGCGATCCAGCGCGGTTTTGGACGCACGGACCG
CGAGCTGATGGAGGACGTGGCCGCCGCCTTCAAGCTGGGTTTCGGTGCCGTCGCTCGCTGCGGATCGTGCGCGCTGCTGGTGTTCGTCAACGGCGGCTCG
GTCCACGTCGCGAACGGTACGATGCTGCTGTGCTGCTGTGGTGATTGGATTTCACCCTTACTGGATGTCGATGCTGATCCTGTGTTTGTGTTCTTGCAGC
TGGTGACATTCGCGCTGTGTTGGGCAAGAGTGATCCGGACAGCACCGATGGCGGGATGCTGGCCGTGCCGATGAGCCACGACCACAATGCCATGTCTCTG
ATCGAGCAGGAGAAGCTGCGCAAGGACCACCCTGGTGAGGCCAATGTATTCACGTGCCGCCATCCCGAATCGTGCTACGTGAAGGGAGCTCTGCAGCCGA
CGCGCGCGCTGGGTGACTTCTCACTCAAGTACTCGGAGTTCAATGGTCCACCGTACGTGAACGGAGACCGGAGTGCTGGACGCCATTTCCCGGTGCCGTA
CTCGCCGCCGTACATCACGGCGATCCCTGAGATCAAGCACCACGCGCTCGAGAGCGGCGACAAGTTCCTGATCGTTGGGTCGGACGGGTTGTGGGACTAC
CTGACGAACGAGGAAGCAGTCGAGGTGGTCCGTGAGCATCTGCTGGCGAAGAACCACGAGCTCGCAGGCCGCGCTCTTGTCGAGCGCGTGCTGCAGAAGG
CCGCCAAGCGCTACGACATGACATACCACGACCTGCTCAGTCTCCCGGCTGGCAGTCATCGCCGTCGGCGCCACGACGACACAACCGTGGTTGTCGTCTT
CTTCGATTAGCAACGTCGCCGGGAGAGCAGTGAGAGGTGCGTTGGTGAATTAAAGTGTCACGAAATTGGATGAGGGGTAGCGACGAAGAACAACGAAGTT
TGTGTCCCTCCACTAGAAAGAGCTGATACAGAGATCACGAAGAGCACATGAGGTGTACTGGAGACAATCGAGATTCCAGTTCAACCACACTCGCAGTTGT
CCCTTTTCGCATTGGCGCTTTTGTGTGCTGTGGGCAGGAAGGGATGCAAGCAGTCTGGATCGCTGTGGTTAGCTTGCTGCTGTAGGTAGTGCTGCTGTTT
ATCCAGGTCCAGCATCAGTGTCGGCTGCTGGTGTCGGCGTGGCGCCAACAGTGAGCGTCACTGGGACGCTGCCTATTGCGTTCCCGGCTGGTGGGTTGGT
GGTGGTAGTGCTCGCCGTGACTTCCTCGTCCAGCAATTGGCGGTACCGGTTGTAGTTGTGCTCGAGCGAGTCCGTGTAAAACTGCATCAGCAAGACACAA
CACAAATCAAACATTAGTCAGGCAACCAAGAAATACACCGCCAAGCTTGCTGCAATGGAGACGCACTCGAAGATGAAGACAGAGCGACGTGAGCGGCAGC
CAGATGGGCCGCACGATGTAGTTGATAAAGTGGAGCTGCACCGTGAGCCGCGTGCGGCGGCTGTCGAGATCCTGCATGAACCAGTCTGTGGGGATCCCAA
GATCCGCCTCCGCCTTTGCTTGGTTCTGGAACTCGTCGAGCATGCGGTGGCTCCAGGCGAACGCTTGCTGGAACGGCAGCGCCTGGTGTGATAGGTCGGC
GGCGTGCACGAGGATCCCCAAGAGCACTGCTCGCTTCTCCGAGAGTTGGCGACGCGTGAGGCTCTCGAGAACCTTGCACTTCTCAAAGTGCTTGGACATG
TCGGTGGCGAGAATGCAAGCGATGATGAGCTGCCGCATACGTCGGTAGCGGTCGACGTCGAGGTACTGGAGGATCTTGGCCGACTTGTGATTGAGGATGA
TGAAGGTGACGCGGCAATGGTGGCGCTCGAGCACAGCGTCGTCGTTGTGAGTGAGCGCCATGGGACTCAGCGTCTTGAGCTCAAAGTCGTTCGTGTTCCC
AGGGTGGTCAATGTTGTGGCAAAGGGAGGCGATCAGCATGGCGAAGATCTCGAACCCGCTGAAGAACTTGCGGCACTCGGTGCGGATCATGATGTGCATG
GTGAGCATGACCTGGAAGGCATGCTGGAAGTTGTGGAACGGGTTGCTGCGGTAGTAGTTGGCCACATTGGACGCGAACGTCGCGAATTTATCGCCCGAGA
TGCGGAAGTACTCCAAGAAACCGTACGCTCGAAAGATGATGCCGCAGCACATGACGATATCACTACTCGAGAAGACACTAGTGTTCGTGTCCCACTGGTC
AAGCGGCTCGCTGACACCTTGCGCGAAGACGATGTCACGCGGGAATGGAACCACGTCATCCTCGTGCTGCTTGTGCTTGACTATTGGCACCAGTGCTGCG
AGCGAGAGCGGCTCCCTGGTCGCCAGCAAGTCGTCTGGTGCACTCACACAGCAGAATTTGTGCACGATCGACGAGATGATGTCCGCCTCCGAGAAGGGAT
CGACATGATTGGTCGACGGCATTCTTCGGGGCGAGAGCGGGGCACCGGTGGCTTGTGGAGCAGAGGCGGCGTTGTCAGCCACACAGTCGGACACGACTTT
GTAGTACGAGATGTCGAGCGAGAGCCGGCCCAGCGCGAACTGCACTTCGCTGCAGAACTTCGTCATGGTGTCCCGATCGAACTTGGTGAAGGCGACGACG
TGCGAGCCTTCCTTCTTGTTGATGCACATGGCGACGGCGACAACCTTGCGATTCGACGCGGCGTGGTCTTCGAAGATGGGCATGCACAGCACGCTCGTGG
TGCGGTAGCCTGTCTTGAGGTCGACGCTCGGGTCGAAGAGCTCGTGCTTGTACGCGTCACGAGTGCATACGGGTTCACCAGTTGTGGCTACAAGTCCCGA
CAGACCGCGGTTCATCGGCGACCGGATGCTCTCGCCGCCGATCTGCGGTGTGATCCACAGTTCCTTCTTGAAGTGGTCGATGAGCAACAGTCCGAAGCGG
TCACACTGCATGATGTCTTTGCCGAGCTGCATGACCAACTCGGCGAACTCGGCAATGTCGGTGCTCTCGGCGATGAAGGTCGTGAGCTGAAGTCGCGCTT
CGATCAGCTTCTGCGCCGTCTTGACCTCGTGCAGCAGACTCGCCTTGTACAGCGACGTGCCGACCGTGTCTGCGGCGTAGTTGAGGAAGATGGCGTCCTC
GTGGGAGAAGTCTGTGCCGTCGACCTTGTTGACGGCCGAGAGCACGGCGAGGATGGTGCCATCCGGTGCCTTGACTGGCAGACACAGAATCCGCTTAGTG
ACAAAGCCAGTTTTGAGATCGAGCGTCGGGTCGAACATGGGGTGAGAATACGCGTCGTTGGTGATGATGGTCTCGCCCGTGCGCGCCACGAAGCCGACAA
TACCTTTGGCGATCGGCACATACTCGCCACGCACGATGTCGGCGGCGCTGGCGATGTACAGCTCGTTCTCTCCTTCCATCTTCATGAAGAGTCCGATGCG
CTCGGTGCCGAGCAGCTCGTGGCAGACGGAGAGCACCTGATCCAGCACGGCAGACGACACGGCCTCCATCGAGAGATTGCGGTGCAGCTTGAGAAGTCCC
TCAATGCGGTTCTGCGCCGTCTGACGCTCGCGCGACAAGATCAAGTTCCAGATGGCAGCGCCGGCGACGACGGCGAGGAACTCGAGCATCTGCTTGTCGG
TGTCCTGGAAGCGCGTCGGCGTGTAGTCGGCCAGCGGCAGCCGCTTGGTTCCTGACTTGCTGACCACTGCTGGAGATATTGTCCGCGCAGTCGAGACAAC
TTGGAGAACACCGACGACTGAGCGGTTGGCGTTGCGGATCGGAAGACACAAGAGAGCGTGCGGTGTGATGCCTGTCATCTCCATCTGACGCTCGTAGTTC
TCGTGCGCGAAGAAGTCTTCGATGCTGAGCGGCTTCCCTGTCATGAGAACGCGGCCGAATGTCGTGGGCGAGTCCGCGGCGATGAAACCCTCGTTCACTG
GGGAGGTTGCGTCGCTGGCACCTGCGAGCTGCTCCGGCTCAGTCGAGAAGATCTCCACGACATTGCGGCGCTCGTTCAGGATTCCCAGCGTGTACTTGTC
GGCGCGCACGAGCTTCTCGGCGGCGTGCAGGATCTTCACGATGACGGTGTCGAAGTTGCCCTGGGACGATATGTCTCTCACGGACGCCACGACTTCTTCC
AGCTGCGCCACACGCTCCGTCGCCACCGACAGCGGCGGAGTCAGCCCCAGTCCCTGACCGCTGGCCACGGCTG